SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10003_c0_seq5
Scaffold_idBomo_Chr11
NCBI non-redundant
(nr)
Ontology
Transcript
Level
FPKM:0.80 TPM:0.88
ORF Entry
Sequence
(Nucleotide)
CAGTTTTAAACAGAGCAAAGTGTGGAAGTTTATGGCGTTGTTTTTAAAATCTTTCCCTTT
GCTACTGTGGCGCCATCTTAACTGGCTCCCTTTCAACGGACACTTTACAATACATTGAGA
TGATGCTCCTAACTTCTACCCCCTTAAAGGGTAGGCTATAGAAAGATGTTAATTGTACTA
CTCAAAGTAATAGTTCTATTTTTCCAACTGGCAAAGCTAAGGTATTAATAATAATAATAA
TAATACAGCGTAATTTTTATTTCATTAATTTTTTAATTCAAAAGAAATGAAGTTAAGGCA
CAGACTACCCTATTATGC
(318 bp)

- SilkBase 1999-2022 -