SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10003_c0_seq1
Scaffold_idBomo_Chr24
NCBI non-redundant
(nr)
PREDICTED:_protein_TEX261_[Papilio_polytes]
Ontology
GO:0006888 P endoplasmic reticulum to Golgi vesicle-mediated transport
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0030134 C COPII-coated ER to Golgi transport vesicle
GO:0030173 C integral component of Golgi membrane
GO:0030176 C integral component of endoplasmic reticulum membrane
GO:0097020 F COPII receptor activity
Transcript
Level
FPKM:2.50 TPM:2.74
ORF Entry
Sequence
(Nucleotide)
CCCGACGAAATATAAAACAAAAAGTACATAAAGAATCATGTTATTCTTGTATTTATTGAG
TTATTTATCTCTTTTTATTCAAGGAGTGTTTATTACCCTGGCTGTAGCCGCTGGCTTATA
TTATCTGGCCGAGATTGTAGAAGATAATACAGTATTTGCTAAACAAGTCATCACGTATGC
TGTATTCACCACCGCAGTCATCCACGTATGTCTAATGATATTCGAGGAGATCCCCCTCCA
GATGAACATCCTAGGTCTGATACAGCAGCTTCTGCACCTGCTTCTGCTGC
(290 bp)

- SilkBase 1999-2022 -