SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10002_c0_seq3
Scaffold_idBomo_Chr17
NCBI non-redundant
(nr)
hypothetical_protein_RR48_11632,_partial_[Papilio_machaon]
Ontology
Transcript
Level
FPKM:2.71 TPM:2.97
ORF EntryO_BomoFB11301_complete:A_BomoFB_comp10002_c0_seq3
Sequence
(Nucleotide)
CAACGAATTAAATTCATTAGAATTTTTTGAGATATTCTTTGAGACACATCATAATAACCT
AACCGCCGCCGCCGCTAACCTTCACATTGAGCCGGCGCAGGGCGCGCGCGGACCCTCCGA
TGTACGCACGCGTCTCTGCGATTCTTTCTAATTAACTGTTTGCATTTGAAACACTTGTCG
ATTGTTTTGCATTATTAATTAATCATTAATTTTACGATGTCATTCAATCTTTAAACGTAC
ATCGGAGATCCGCAACGCTGGACAAACTATTTCAACGTGGACGTTCTTTTTTCAAGTCTC
ACAATAAAAATGTAACACGAAAGTGTTGAAGCCAAACATTGAGTCCACGTTCTGCTGCTA
TTGTTGTACGATATTGATGAGTCTGGACGAGAGGAACGTTCACGTTAGTGAGTCGCAAGT
CGGAGACGTGAGTGTGGTAGCGAGTTGTGAAGGTTGTGGGCCAGCTGCAGGTGTGTGTGC
GTCAGATTCAGAGCGCGGCCGGGAGCTGGGCGCCGCGCTCGAGCCCTCCCCGCCGCGGGG
ACCCTTCGACCTCCGCGACCCCGACCACTTCCCCCCCATCGCCGTCAGGGCACCGCAGCA
CTAGGACCGCCGCGCCCGCCGGACAGAACTTTCAATGTTTAGTTCAATTCTACAAAACAT
ACACCTACATCAAACTTTATGTAATTAATATAGATATCTAAAAGATTGTTTGTGTCAGAA
ATATTGACCAGAACTTGGACCCGTGGGACGGGGCCCGACGTGGCCCGCCGCGAGCCGCTA
GTGTAAGTTGTCGTCCGACTGTCTTGTCCCTTAGATAAGTCGTTTTTACAATTTTATCAC
TATCTCGATTATATTATTGTAGACAAATTTTACAAATTTCATATAAATTAAATTCAAATT
GTATTTACTTTGATATTATATACTAAAAGCATGTGACATTACTAAATTTAGGAATAAAAA
CAAAACAAAAAATAATAAATATTTCAATAATTCTATATTAAATCCGGACAGACAGATGAG
ACGACGTTAGTGTAATTATTGTAATATATTTAGTTAAATTGACCCTGTCTCTTTGTTCTA
TGACTTTATAGTGCAGCTTACAATTATAAGATCTGAAATAATAAAATAAAAATGTAAAAG
GAAATGCAAATAAATAATAAACAAGATAAAAGTTTATTTATGAAGAAGCGCGCGGGGCGT
GCCGCGGGGCGCGGGGTGCGGGGCGCACTCTTGCACGTGGCTGCGGCAGCTGGGCGGCCG
CTAGAGGCTGCTAGTGACTGCACAGTGCACAGTGCACGCTGACCACAGATAATAATACAC
TTAATGTGACGAGCGGCGACGAGAACCCGTCCGAAGCGCGCAGCGTTGGAATACAATTTA
AAAAATAACAACAAAACTACAAACCGTAGACGCGACTCGATGCTCACTAACGTGCATCTA
GACATTTCTGTAATTTCAAAGGCAAAAAACTTGTATAAACAAATTGTAAATTTTTATTAT
AATTTATTGTATATTAGTGGGACTTCGTAAAATAATTTAAAAAAAAACTATCAGAGGGAC
CGCCCTCGCGACCTCCGTGTCAATATAAATATCGTGAAGTTCGGATTATAATAAAGTGAG
TAATTATATAAGTGACTGTATCTCCACATCGGCGTTTGTATATAATTAGAGGTGTCATCT
GAAGCCACGAGCGGCTGTAATATTTAAATAACAATTAGTCTAGCGGTTAGCGAGATATAC
AATCGTCAAATTAAATACATGGCAACACTTCTTCCTCTGTCTCACTGTAACATATGTTGC
CTATTTCGAAACCAAACAGTGGCTATAGCTAAAATATAAAGAACTTAATATACGTAGGTA
CAAATTCT
(1868 bp)

- SilkBase 1999-2022 -