SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10002_c0_seq2
Scaffold_idBomo_Chr17
NCBI non-redundant
(nr)
drug_transporter_[Moniliophthora_roreri_MCA_2997]
Ontology
Transcript
Level
FPKM:18.99 TPM:20.81
ORF Entry
Sequence
(Nucleotide)
CATCTTGACCAGCCAGCGTGCGCGTCTCCATAACTTTTAACTTCTCTTTAATTATAGTGA
AACATTTTTAGTGGTAGACATACAACTAGATTGCGATTACGGAACAAATTCTACGATGAC
AAAGTAAAAATAATACACCAGAGTATTCTGTACAATTTATAAATTGAAGGTAGCAGTAGG
AGCAGGCGCGCGGAGGTAGACTGCGGGTGATGTAAAGTTTGTCTCCTTTGTCCGGTCGGA
GCCTGTTACATCTCTGAGCAAGTCGCAGCGGAGCGTTAAAAGCTATAGACACACGCACCT
TAAGGAGCACACACGGAACTAAAATAAATACTAGAATTTGTACCTACGTATATTAAG
(357 bp)

- SilkBase 1999-2022 -