SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10001_c0_seq3
Scaffold_idBomo_Chr24
NCBI non-redundant
(nr)
Ontology
Transcript
Level
FPKM:2.39 TPM:2.62
ORF EntryO_BomoFB11299_5prime_partial:A_BomoFB_comp10001_c0_seq3
Sequence
(Nucleotide)
ATATAATCTCCGTCATCACAGTAACAATCTTGTCTTGGCTCATTTGCTCTCCAGTTGAGA
GATTACAACCAACAATGTCCAATGCATTGAGTACGCCTTTACTTTCACAACAGTGTTTTA
AGTTGATTTAAAAAATAAAAAAAATTCATGATTGACACTGCTTTTTGTTTTCTTGTTCAT
GTAAAACTTGTACCTATCAAACTAATAGCTTTATAATGACTTTGCATACATTCAACTCCA
ATCTGTGTAACCTTCTTTCCAAGCCCAATCGTCTGTCTCCAGTGCATGCGTTGAGTCCCA
TGTAGTTGCTTGGTCATCATATTCTATATGGCCTTGTGACTCCTTTCCGGGGTGACCAGA
ATTTTCTTGACTGGATTCCAGCACGGGTTCGGTCTGAGTAGAACTAATTTGGCTACCCTC
GTTTTGCTTACGTAAACTGAATTCATTATCTATTGGCTTATTAACTACGTCGACATCTGT
GCATTGTTTCTTGTAATTCTCTTCATCTCTTGTACAATAATTTACTGATTTCCCTCCATT
GTTAACGCTAAGATGGTGCTTCGATGATTCTTGTCTATTTCTTATAAGGTTTTCTAATTC
AGTTGAAAGTTTACATTTTTTATTAACAATCATCAATTCCTCATCGCCTTTCCTCTTGCT
CAGTACTTTTCCTCCAGATGTGTCTTGGGATTTTGGTTCTTGCTTTTTATCTTTAGTAGG
TGTGTTTGATCTATCCAATGGACTGTGTTGATTTAGAGACTGGGGTATGAGATTTGATTT
GTCAGATATCAACAGGTCTGCGTTTGCAGGAATGATGGGCTTTATTTCGGTTATGACTTT
TGGATGGCAAATTGGATCTGTTTCATTGGCATATGGGGAAGTTATTTTTTGTTGACAATC
TGAAATTTGTTGATTTATGACGGTAGGTATTGGTTTTGGTTGGTAAATTGACTTTTGGGG
GCCAATAACCTCTGGTACTGTGTGTTGGTTGACCTGTGGCACCTGGGGTACTGCAATTGG
CGCGCAAACTAAGCTTTGTTGAACTGGGATAACGAGCTGGGGTACAATGTTTTGTGCGTA
ATTCACGACTGGTTGATGAACAAACTGGGGCATTACTGTTCGTCCATGAACTACTCCGTG
GTAAGCATATGAGTTTTGTTGATTTAAAAATTGTGAGATAAGACTTTGTTGGTCGCTTGC
CAAATGTTGGTTGGCTATTAGAGGAATGGAATTAATTTGACAACTTGAATTTTGTTGGGA
TCTCAAACTGGAAATGACTTCAGGTTGAGAACTTGGTATATTTTCAAAGTGGGTATTCGG
TTTCCATACTGAACTTGTATGATTTTCAAACTGAGGAATGATGTTCTGTTGGACAAAAGA
TTCTTGTAGATTTACAAACGGATGTGATGCTTTTGTTTGACAAATCGATCGTATTTCATT
CTCATTAGAATTTAATTCCCACTTCACTTCTTG
(1473 bp)

- SilkBase 1999-2022 -