SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp10000_c0_seq1
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)
PREDICTED:_LOW_QUALITY_PROTEIN:_translational_activator_GCN1_[Bombyx_mori]
Ontology
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005844 C polysome
GO:0006417 P regulation of translation
GO:0016020 C membrane
GO:0019887 F protein kinase regulator activity
GO:0019901 F protein kinase binding
GO:0033554 P cellular response to stress
GO:0033674 P positive regulation of kinase activity
GO:0034198 P cellular response to amino acid starvation
GO:0036003 P positive regulation of transcription from RNA polymerase II promoter in response to stress
GO:0043022 F ribosome binding
GO:0044822 F RNA binding
GO:0045859 P regulation of protein kinase activity
GO:1990253 P cellular response to leucine starvation
Transcript
Level
FPKM:12.12 TPM:13.28
ORF EntryO_BomoFB11297_5prime_partial:A_BomoFB_comp10000_c0_seq1
Sequence
(Nucleotide)
TTTAATTAGACAATTATTTTATTACATTAGTTCATTAAAATATGATGCCTGCGCTCAGGT
GATGAGCGTACAGTCCAGGTCCTCATCTCGTCCGTCGGGTTGAGGTCGACGCAATACTCT
CGCTACTACATCAGACAGAGCTTCACGGGCGCCTTCCTCCAGGAACGACACGCATCGCTG
GAAATAGTCTGGTTCAGAATGAAGCCGCAGCAGGGTTCGGAGCGAGGACTCCGCGTTGGC
GCGCACGTACGAGTTCTTCTCCTTGGTGCCGTTGACGAGGGCGGGCAGCACGGCACGCAG
GAGCTCCGGGTTGTCGGCCTCGCGACCCAGGGCGCCGCTGGCCCGCGCCATCATCTGCTT
CACCTCGTTGCTTTGATGGTTCATGCTTCTGACAAATTGCGAAAGTATGTTCTGTGGGAG
CGGCCTGTCGTTCTGGAGGAGATACTTCATGAGGAAGCCGATGCCGCGGATACCGTTACA
GACGATCGGGATCTTGTCGCTGGCCAGGTACGCCAACAGGGTTTTGTCTATCTTTTCTTC
GTAATGATCGCGGTATATAGAGGCCGGGGTCTCCTTGAGTGCCACGAAGAGAGCACAGGA
GCGGCCGTGTTGGAGCAGCCAGTCGTCGGATTGTGCCAAGACGTGGTGTTGCAGGGCAGC
GTCGTGGTGTGCGGACGGCAACCAGTGCAGCAGGGCGCCCAGACAGCCCCCCACCGCTCC
CCGGGGCGGGTCCTCCGGGTGCGCCAGGAGCGCGGGGCTCGTCAGCGTCGACAGAATACT
GAGCGCCAGTTGCTCCGATAGCTTGTCTCCGCCGCCGGAGATGATGCTGCGCAACGCTTG
CAGCATGGTCTCCCTTATGGCGGGGTCGTCTGTATTCTTAATGCCGTTGTGCATCTCCAC
AAAGAGCGGATCCGCTCTGGTGTGGATGATGACCAGTTGTGACAGAGCCAGGCCCGCCTT
GATCCGCACGGGCCGGTTGGGATCGTTGAGGGCCTTCAGGAACGTCGTCTGCAGTTGCGG
TAAGAACTGCTTCAGCATTACCCCGACCTTCGAGAGTAAAGAGGCTAAGGTCTCCAAAAC
GGCAGCTTTGACGCTAGAGTTGAACCTGTCTCCGAGGATACGGATGAGAGGTCCGGTGAT
GTGTACGACGGAGGGCTGTATGGCGGCCGGAGACGTCAGCTTGATGACCTCGCCCAGCAT
CAGCGCCGCATTTTCCTTGTCTTCAGGTAAGCCGTTTAGGATAGACTCCCGGAACAGAGG
CAGGATCGGCGCTATACCCTTGGGCAGACAGAATCCGGGCAAGAGATCCCCCTTGAGGTC
GGCGGCCGCATAGCGCACGGCCTGGCGCACGTCGGACACGTGCTGGATCTGCCGCTCGGC
GTCCAGCGTCTTGGTCAGCGCGGAGAGCGCCTCCCACGCCATGAGCAGCACGTCTCGGTC
GTCGTCGGCCAGCAGCAGCACCAGGCCCCGCAGCAGCTGCGGCACGTGCGGCTCTAGGTC
GCCGCGGGTGTGCGCGACGAAGGCGCACAGCAGCACGGCG
(1540 bp)

- SilkBase 1999-2022 -