SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameA_BomoFB_comp0_c1_seq1
Scaffold_idBomo_Chr10
NCBI non-redundant
(nr)
teashirt-like_protein_[Danaus_plexippus]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0003677 F DNA binding
GO:0005634 C nucleus
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007275 P multicellular organism development
GO:0007380 P specification of segmental identity, head
GO:0010468 P regulation of gene expression
GO:0046872 F metal ion binding
GO:0048730 P epidermis morphogenesis
GO:0048749 P compound eye development
GO:0061330 P Malpighian tubule stellate cell differentiation
Transcript
Level
FPKM:3.56 TPM:3.90
ORF Entry
Sequence
(Nucleotide)
ACTGTTTCGAAGAACCGCTAGAAGAAGATGAATTGTGCGATGGAGTCGATGGTGAACTAG
TGGGAGTTTGTAAGGATGGTGGGATCGGTGCACCTGTAGATGGTGGCACTGGCACATTTA
CACCACAATGCTTGGCCTCTTTCATGTGAACTGTAAGATCTGCTAGAGAATTGAAGCTCT
TCTTACACCACACACATTTAA
(201 bp)

- SilkBase 1999-2022 -