SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_BomoEE_comp69796_c0_seq2
Scaffold_idBomo_Scaf015
NCBI non-redundant
(nr)
leucine-rich_repeat_G_protein-coupled_receptor_2,_partial_[Chilo_suppressalis]
Ontology
GO:0001657 P ureteric bud development
GO:0001933 P negative regulation of protein phosphorylation
GO:0002042 P cell migration involved in sprouting angiogenesis
GO:0002689 P negative regulation of leukocyte chemotaxis
GO:0005095 F GTPase inhibitor activity
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005578 C extracellular matrix
GO:0005615 C extracellular space
GO:0005737 C cytoplasm
GO:0005886 C plasma membrane
GO:0006935 P chemotaxis
GO:0007275 P multicellular organism development
GO:0007399 P nervous system development
GO:0007411 P axon guidance
GO:0007420 P brain development
GO:0008045 P motor neuron axon guidance
GO:0008201 F heparin binding
GO:0009986 C cell surface
GO:0010593 P negative regulation of lamellipodium assembly
GO:0010596 P negative regulation of endothelial cell migration
GO:0014912 P negative regulation of smooth muscle cell migration
GO:0016020 C membrane
GO:0021510 P spinal cord development
GO:0021834 P chemorepulsion involved in embryonic olfactory bulb interneuron precursor migration
GO:0021836 P chemorepulsion involved in postnatal olfactory bulb interneuron migration
GO:0021972 P corticospinal neuron axon guidance through spinal cord
GO:0030154 P cell differentiation
GO:0030308 P negative regulation of cell growth
GO:0030336 P negative regulation of cell migration
GO:0030837 P negative regulation of actin filament polymerization
GO:0031290 P retinal ganglion cell axon guidance
GO:0031667 P response to nutrient levels
GO:0032870 P cellular response to hormone stimulus
GO:0034260 P negative regulation of GTPase activity
GO:0035385 P Roundabout signaling pathway
GO:0042802 F identical protein binding
GO:0042803 F protein homodimerization activity
GO:0043065 P positive regulation of apoptotic process
GO:0043116 P negative regulation of vascular permeability
GO:0043237 F laminin-1 binding
GO:0043394 F proteoglycan binding
GO:0043395 F heparan sulfate proteoglycan binding
GO:0048495 F Roundabout binding
GO:0048754 P branching morphogenesis of an epithelial tube
GO:0048846 P axon extension involved in axon guidance
GO:0050728 P negative regulation of inflammatory response
GO:0050772 P positive regulation of axonogenesis
GO:0050919 P negative chemotaxis
GO:0050929 P induction of negative chemotaxis
GO:0051058 P negative regulation of small GTPase mediated signal transduction
GO:0051414 P response to cortisol
GO:0061364 P apoptotic process involved in luteolysis
GO:0070062 C extracellular exosome
GO:0070100 P negative regulation of chemokine-mediated signaling pathway
GO:0071504 P cellular response to heparin
GO:0071672 P negative regulation of smooth muscle cell chemotaxis
GO:0071676 P negative regulation of mononuclear cell migration
GO:0090024 P negative regulation of neutrophil chemotaxis
GO:0090027 P negative regulation of monocyte chemotaxis
GO:0090260 P negative regulation of retinal ganglion cell axon guidance
GO:0090288 P negative regulation of cellular response to growth factor stimulus
Transcript
Level
FPKM:0.20 TPM:0.35
ORF EntryO_BomoEE19532_5prime_partial:A_BomoEE_comp69796_c0_seq2
Sequence
(Nucleotide)
GTCGCGCAACCTGCTCCGCGCCGTGCCCACGCACGCGCTGGCGCCGCTGCACCACCTGCA
GACGCTGAGTCTCTCCGGGAACCTGATCACCGAGCTGTCAGACTCCTCGCTGCCTCCGCT
GCCCGCGCTGCACACGCTAGTCCTGAAGAGGAACCGCATCACCCACATAGAGCCTCGCGC
CTTCGCTAACACTCCCGCCCTGCACGTGCTACGCCTGGAAGAAAACCTACTATCGGAACT
TCCGCCAGCGATACAGCTACTGCCCGTGCTACAAGATCTGTTGTTGAGTGGGAACCGCAT
CGAGGTGGTGGAGGCCGGTATTCTCCAACAATGTCGTCTCTTGAAGCGGCTGGACCTCCG
CGGCAACCCGCTCACTCGCCTCCACAGACATGCGCTGCAGCATCTGCCGCATCTCAGGAC
GCTGTGAGCACATTTCAACAACAATCTACTCATGCCTACTTTATATTATTTAAGAAATGT
TTAATTCTGCATGTAACCAGACCGGTGGTGAAATTATATGCAAGTGTATGCTAGGAAAGT
GTCCGTAAAGGTCTATTTGAAATAAAATAAACGCATTGTAGTCAATAATTCCTCTAAGGC
GGC
(603 bp)

- SilkBase 1999-2023 -