SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoEE_comp69682_c0_seq1
Scaffold_idBomo_Chr9
NCBI non-redundant
(nr)		PREDICTED:_desert_hedgehog_protein_B_[Papilio_xuthus]
Ontology
GO:0001569 P branching involved in blood vessel morphogenesis
GO:0001570 P vasculogenesis
GO:0001656 P metanephros development
GO:0001658 P branching involved in ureteric bud morphogenesis
GO:0001666 P response to hypoxia
GO:0001708 P cell fate specification
GO:0001755 P neural crest cell migration
GO:0001841 P neural tube formation
GO:0002052 P positive regulation of neuroblast proliferation
GO:0002320 P lymphoid progenitor cell differentiation
GO:0005102 F signaling receptor binding
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005615 C extracellular space
GO:0005783 C endoplasmic reticulum
GO:0005794 C Golgi apparatus
GO:0005886 C plasma membrane
GO:0006508 P proteolysis
GO:0007154 P cell communication
GO:0007224 P smoothened signaling pathway
GO:0007267 P cell-cell signaling
GO:0007275 P multicellular organism development
GO:0007389 P pattern specification process
GO:0007405 P neuroblast proliferation
GO:0007411 P axon guidance
GO:0007417 P central nervous system development
GO:0007502 P digestive tract mesoderm development
GO:0007507 P heart development
GO:0008209 P androgen metabolic process
GO:0008233 F peptidase activity
GO:0008270 F zinc ion binding
GO:0008284 P positive regulation of cell population proliferation
GO:0009790 P embryo development
GO:0009949 P polarity specification of anterior/posterior axis
GO:0009953 P dorsal/ventral pattern formation
GO:0009986 C cell surface
GO:0010243 P response to organonitrogen compound
GO:0016020 C membrane
GO:0016539 P intein-mediated protein splicing
GO:0016787 F hydrolase activity
GO:0021513 P spinal cord dorsal/ventral patterning
GO:0021521 P ventral spinal cord interneuron specification
GO:0021930 P cerebellar granule cell precursor proliferation
GO:0021978 P telencephalon regionalization
GO:0030133 C transport vesicle
GO:0030162 P regulation of proteolysis
GO:0030324 P lung development
GO:0030326 P embryonic limb morphogenesis
GO:0030336 P negative regulation of cell migration
GO:0030424 C axon
GO:0030425 C dendrite
GO:0030539 P male genitalia development
GO:0030850 P prostate gland development
GO:0030856 P regulation of epithelial cell differentiation
GO:0030900 P forebrain development
GO:0030901 P midbrain development
GO:0030902 P hindbrain development
GO:0032355 P response to estradiol
GO:0032526 P response to retinoic acid
GO:0033077 P T cell differentiation in thymus
GO:0033089 P positive regulation of T cell differentiation in thymus
GO:0033092 P positive regulation of immature T cell proliferation in thymus
GO:0042127 P regulation of cell population proliferation
GO:0042733 P embryonic digit morphogenesis
GO:0043025 C neuronal cell body
GO:0043066 P negative regulation of apoptotic process
GO:0043237 F laminin-1 binding
GO:0043369 P CD4-positive or CD8-positive, alpha-beta T cell lineage commitment
GO:0043586 P tongue development
GO:0043587 P tongue morphogenesis
GO:0045059 P positive thymic T cell selection
GO:0045060 P negative thymic T cell selection
GO:0045121 C membrane raft
GO:0045471 P response to ethanol
GO:0045596 P negative regulation of cell differentiation
GO:0045666 P positive regulation of neuron differentiation
GO:0045880 P positive regulation of smoothened signaling pathway
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0046534 P positive regulation of photoreceptor cell differentiation
GO:0046638 P positive regulation of alpha-beta T cell differentiation
GO:0046872 F metal ion binding
GO:0048468 P cell development
GO:0048538 P thymus development
GO:0048663 P neuron fate commitment
GO:0048678 P response to axon injury
GO:0048754 P branching morphogenesis of an epithelial tube
GO:0048808 P male genitalia morphogenesis
GO:0048864 P stem cell development
GO:0060406 P positive regulation of penile erection
GO:0060441 P epithelial tube branching involved in lung morphogenesis
GO:0061196 P fungiform papilla development
GO:0061197 P fungiform papilla morphogenesis
GO:0061198 P fungiform papilla formation
GO:0070447 P positive regulation of oligodendrocyte progenitor proliferation
GO:0072136 P metanephric mesenchymal cell proliferation involved in metanephros development
GO:0097190 P apoptotic signaling pathway
GO:2000062 P negative regulation of ureter smooth muscle cell differentiation
GO:2000063 P positive regulation of ureter smooth muscle cell differentiation
GO:2000357 P negative regulation of kidney smooth muscle cell differentiation
GO:2000358 P positive regulation of kidney smooth muscle cell differentiation
GO:2000729 P positive regulation of mesenchymal cell proliferation involved in ureter development
Transcript
Level		FPKM:0.38 TPM:0.67
ORF EntryO_BomoEE19268_complete:A_BomoEE_comp69682_c0_seq1
Sequence
(Nucleotide)
AATAAAAAAAATAAAAAAAATTTGTTTATTTCGTAACGCAATTAATTATTTGCAGCGGCT
GGCTATACCCCTGGAATTAGTGATGTTCATTAACATTGATAACCACTCACCATCATGGAG
GCTGTATGCATGAATTCCTTTTAAAGAAATAAAAAGTTAGGAGCTTAAGCTGATTAAATA
ACTTAGTTGCTTTGTAGTTGCCACGATATATAGCTTTTTATTCCACTTAACAATTACTTA
TACATATCATTCTTGATTGTTTGATTGCTTTTCTGTTATGCAGCACCCTGTAGTTAAAAG
CTTCCTGTATCCCTCCCTACCTTTTCTTGCCCTAGGCTGTATGCAACCAACTTTTCCTGT
CTTATTTATTATGTCACCAGCCCATTTTTTCTTCTGTCTTCTTACGCTTCTTTTGCCTTT
TGGGTTACTCTTTGGTTTATTGGTAAGTCTATCTCTTGTCTTTGTACCAAAGTGCCCTGA
GTCATTAGACGATCAGCGCCAGTGCCTTCGTCGTCCCTAAAGTCTATATCCGGATTATAA
TTAGGCACTAAGTCTTTAAATCTCTCGTCATCTCTGGTGATGCGGCCCTCGGGAGGACCA
CTGGCGGTGTTCTTATTTTCGCTAACATTCGGATCGTGCTGGCCAAAGACAAGGGGGGTG
ATGCGGCGCGGTCCGTGGCGACGGTTGAAACCGCGGCCCGGGCCGCATGCCGCCGCCGCA
CCCAACCACAGAAGCACCAGCGAGAGCCTCATCTCGCAGACATCACTCCACACGCGCTCG
ACGCACGACCACCGCGCGCCGCGACTTGAGCGACACTGAGAGCAACTGCCACAACCCGAC
TCAACTGCACGTCCACCACCGAGCCTGAACTTGCATCCCTTGCTTGCCGCCCGACACCCA
TGAGCAAGCATTCCCACCACCGTTAATCTCCCACTTCACTTATAACTCGCTACCCACAGC
ACATTAAGCGATGACGCGCTCCCTGGGGAAATCCTATTAACCTAACGCGGACGCAATACA
ATATACATAATCAACTACCCTAGTTTGTGTCAAGCACGGTTATCCCCCG
(1069 bp)

- SilkBase 1999-2023 -