SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoEE_comp64269_c0_seq6
Scaffold_idBomo_Chr27
NCBI non-redundant
(nr)		PREDICTED:_paired_box_protein_Pax-5_isoform_X6_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000978 F RNA polymerase II cis-regulatory region sequence-specific DNA binding
GO:0000982 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0000987 F cis-regulatory region sequence-specific DNA binding
GO:0001655 P urogenital system development
GO:0001656 P metanephros development
GO:0001657 P ureteric bud development
GO:0001658 P branching involved in ureteric bud morphogenesis
GO:0001709 P cell fate determination
GO:0001822 P kidney development
GO:0001823 P mesonephros development
GO:0001843 P neural tube closure
GO:0002072 P optic cup morphogenesis involved in camera-type eye development
GO:0003337 P mesenchymal to epithelial transition involved in metanephros morphogenesis
GO:0003406 P retinal pigment epithelium development
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005667 C transcription regulator complex
GO:0005730 C nucleolus
GO:0005794 C Golgi apparatus
GO:0005815 C microtubule organizing center
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007275 P multicellular organism development
GO:0007417 P central nervous system development
GO:0007501 P mesodermal cell fate specification
GO:0008134 F transcription factor binding
GO:0010001 P glial cell differentiation
GO:0016175 F superoxide-generating NAD(P)H oxidase activity
GO:0021554 P optic nerve development
GO:0021631 P optic nerve morphogenesis
GO:0021633 P optic nerve structural organization
GO:0021650 P vestibulocochlear nerve formation
GO:0030154 P cell differentiation
GO:0031016 P pancreas development
GO:0032993 C protein-DNA complex
GO:0034451 C centriolar satellite
GO:0035566 P regulation of metanephros size
GO:0035799 P ureter maturation
GO:0039003 P pronephric field specification
GO:0042472 P inner ear morphogenesis
GO:0042981 P regulation of apoptotic process
GO:0043010 P camera-type eye development
GO:0043066 P negative regulation of apoptotic process
GO:0043067 P regulation of programmed cell death
GO:0043069 P negative regulation of programmed cell death
GO:0043154 P negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
GO:0043234 C protein-containing complex
GO:0043491 P protein kinase B signaling
GO:0044212 F transcription cis-regulatory region binding
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045918 P negative regulation of cytolysis
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0048793 P pronephros development
GO:0048854 P brain morphogenesis
GO:0048863 P stem cell differentiation
GO:0050679 P positive regulation of epithelial cell proliferation
GO:0055114 P obsolete oxidation-reduction process
GO:0060231 P mesenchymal to epithelial transition
GO:0061205 P paramesonephric duct development
GO:0061360 P optic chiasma development
GO:0070301 P cellular response to hydrogen peroxide
GO:0070742 F C2H2 zinc finger domain binding
GO:0071260 P cellular response to mechanical stimulus
GO:0071300 P cellular response to retinoic acid
GO:0071333 P cellular response to glucose stimulus
GO:0071542 P dopaminergic neuron differentiation
GO:0072001 P renal system development
GO:0072075 P metanephric mesenchyme development
GO:0072108 P positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis
GO:0072162 P metanephric mesenchymal cell differentiation
GO:0072164 P mesonephric tubule development
GO:0072172 P mesonephric tubule formation
GO:0072177 P mesonephric duct development
GO:0072179 P nephric duct formation
GO:0072189 P ureter development
GO:0072197 P ureter morphogenesis
GO:0072205 P metanephric collecting duct development
GO:0072207 P metanephric epithelium development
GO:0072221 P metanephric distal convoluted tubule development
GO:0072289 P metanephric nephron tubule formation
GO:0072300 P positive regulation of metanephric glomerulus development
GO:0072305 P negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis
GO:0072307 P regulation of metanephric nephron tubule epithelial cell differentiation
GO:0072593 P reactive oxygen species metabolic process
GO:0090102 P cochlea development
GO:0090103 P cochlea morphogenesis
GO:0090190 P positive regulation of branching involved in ureteric bud morphogenesis
GO:1900212 P negative regulation of mesenchymal cell apoptotic process involved in metanephros development
GO:1900215 P negative regulation of apoptotic process involved in metanephric collecting duct development
GO:1900218 P negative regulation of apoptotic process involved in metanephric nephron tubule development
GO:2000378 P negative regulation of reactive oxygen species metabolic process
GO:2000594 P positive regulation of metanephric DCT cell differentiation
GO:2000597 P positive regulation of optic nerve formation
Transcript
Level		FPKM:0.14 TPM:0.24
ORF EntryO_BomoEE10487_3prime_partial:A_BomoEE_comp64269_c0_seq6
Sequence
(Nucleotide)
CGGCCCTGCGACATCAGCCGCCAGCTGCGCGTCTCGCACGGATGTGTCTCCAAGATACTC
TCCAGGTACTACGAGACGGGCAGCTTCAAGGCCGGCGTGATCGGTGGCTCCAAGCCGAAG
GTGGCGACGCCGCCGGTGGTGGACGCCATCGCGGCCTACAAACGCGAGAACCCAACCATG
TTCGCGTGGGAGATCCGCGACCGACTCCTCAGCGAAGGCATCTGCAGCCAGGACAACGTG
CCTTCCGTCTCCAGCATTAACAGGATCGTCCGCAACAAGGCCGCGGAGAAGGCGAAGCAC
GCGCACAACCAGCAGCAGCAGCAACAGCAGGAGCAGGAGATCTCCTCCGCGCAGGGCAGC
GTCGTCTCTGTGATAACGCACGCGGGCAGCGGCGGCGCCGGGACCGGGGAGCCGCCCGCC
AGCTACAGCATCAACGGCATCCTGGGCATCGAGCACGTGGACGCGCTGCCCCCCGCGCCC
GCCGCACCTCCCGCACTCAAGCGGAAGCGCCACGAGGACCAGGGTCAGTGCCGCACCCTC
ACTCAGCACACACACACGGACTGCGCTAAACATCACATCGATATGTTATGTTATAAGCAA
TAATCTCACATCAAGGGCTTCCGATCGGAGGAAGATCGTACATTTGTATCCAAAGCGCGC
ACCTCCATGTTCTTATTTCTAAAGATTCGTACTATAATGGAGGTCTCGGCGATGTCGTTA
GGTGAG
(726 bp)

- SilkBase 1999-2023 -