SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoEE_comp1006488_c0_seq1
Scaffold_idBomo_Chr21
NCBI non-redundant
(nr)		Ras-specific_guanine_nucleotide-releasing_factor_1_[Papilio_xuthus]
Ontology
GO:0001975 P response to amphetamine
GO:0005085 F guanyl-nucleotide exchange factor activity
GO:0005089 F guanyl-nucleotide exchange factor activity
GO:0005096 F GTPase activator activity
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0007264 P small GTPase mediated signal transduction
GO:0008022 F protein C-terminus binding
GO:0016323 C basolateral plasma membrane
GO:0016327 C apicolateral plasma membrane
GO:0017016 F small GTPase binding
GO:0019901 F protein kinase binding
GO:0030426 C growth cone
GO:0030971 F receptor tyrosine kinase binding
GO:0031175 P neuron projection development
GO:0032869 P cellular response to insulin stimulus
GO:0035020 P regulation of Rac protein signal transduction
GO:0035023 P regulation of Rho protein signal transduction
GO:0035556 P intracellular signal transduction
GO:0043025 C neuronal cell body
GO:0043547 P positive regulation of GTPase activity
GO:0046578 P regulation of Ras protein signal transduction
GO:0046579 P positive regulation of Ras protein signal transduction
GO:0048146 P positive regulation of fibroblast proliferation
GO:0048167 P regulation of synaptic plasticity
GO:0071236 P cellular response to antibiotic
GO:0090630 P activation of GTPase activity
GO:0097440 C apical dendrite
Transcript
Level		FPKM:0.44 TPM:0.77
ORF Entry
Sequence
(Nucleotide)
GAACACTGACCGAAGCATTGCGTTCCATGGGCGATTTGCTAAGTCTCTCGCAGTATGATC
CTTCCAGAAGGAGCACGCCAGTGGGACGAGTGTTGTTCTCCGATTCGTAATAAAACAGAA
TGTTCTGATACAGAACGAACCATCTTAACTGCCATTTCGTGTTGTCGGAACTCCGCTTGT
GCAAGTACCCGGCCTGTGAGTGGTCAAATTGCGCTCTATCAGATAGCGCAAGGAGCTGGC
CGTCATTGACTCTAACTGAGCG
(262 bp)

- SilkBase 1999-2023 -