SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoBR_DN17452_c0_g2_i1
Scaffold_idBomo_Chr1
NCBI non-redundant
(nr)		transcription_factor_crocodile_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0001077 F DNA-binding transcription activator activity, RNA polymerase II-specific
GO:0001501 P skeletal system development
GO:0001503 P ossification
GO:0001568 P blood vessel development
GO:0001569 P branching involved in blood vessel morphogenesis
GO:0001656 P metanephros development
GO:0001657 P ureteric bud development
GO:0001756 P somitogenesis
GO:0001822 P kidney development
GO:0001945 P lymph vessel development
GO:0001946 P lymphangiogenesis
GO:0001974 P blood vessel remodeling
GO:0003007 P heart morphogenesis
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0003705 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006366 P transcription by RNA polymerase II
GO:0007219 P Notch signaling pathway
GO:0007275 P multicellular organism development
GO:0007498 P mesoderm development
GO:0007507 P heart development
GO:0008283 P cell population proliferation
GO:0008286 P insulin receptor signaling pathway
GO:0009725 P response to hormone
GO:0010595 P positive regulation of endothelial cell migration
GO:0014032 P neural crest cell development
GO:0030199 P collagen fibril organization
GO:0031490 F chromatin DNA binding
GO:0033630 P positive regulation of cell adhesion mediated by integrin
GO:0035050 P embryonic heart tube development
GO:0035470 P positive regulation of vascular wound healing
GO:0042802 F identical protein binding
GO:0043010 P camera-type eye development
GO:0043565 F sequence-specific DNA binding
GO:0044212 F transcription cis-regulatory region binding
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046620 P regulation of organ growth
GO:0048010 P vascular endothelial growth factor receptor signaling pathway
GO:0048341 P paraxial mesoderm formation
GO:0048343 P paraxial mesodermal cell fate commitment
GO:0048701 P embryonic cranial skeleton morphogenesis
GO:0048703 P embryonic viscerocranium morphogenesis
GO:0048704 P embryonic skeletal system morphogenesis
GO:0048844 P artery morphogenesis
GO:0050880 P blood vessel diameter maintenance
GO:0055010 P ventricular cardiac muscle tissue morphogenesis
GO:0060038 P cardiac muscle cell proliferation
GO:0072011 P glomerular endothelium development
GO:0072112 P glomerular visceral epithelial cell differentiation
GO:0072144 P glomerular mesangial cell development
GO:0090050 P positive regulation of cell migration involved in sprouting angiogenesis
GO:1902257 P negative regulation of apoptotic process involved in outflow tract morphogenesis
Transcript
Level		FPKM:0.00 TPM:0.00
ORF EntryO_BomoBR8118_3prime_partial:A_BomoBR_DN17452_c0_g2_i1
Sequence
(Nucleotide)
GAACGAGCAACGCGTCGAGGTTTCAGTGGTTTCGGTGTGAGCATGTCGTCGCAGTGAACT
TTAACTTACAAAATGCATGCTCTTTTCGGTGAACAAAGCCCATATGCGTACCGCGGTGGT
GCGGCCGGTGGATATTCAGCCGGCGTCGCACCATACGCTTATGAACAATATCGCTATGGT
TATGGAGCCCCGTACCTCCACCCGCATCAGCAGCATGTGGGGGCACCGAAAGACATGGTC
AAACCGCCATACTCGTACATAGCCCTTATTGCGATGGCAATACAGAATGCACCAGAGCGG
CGCATCACGTTGAATGGTATTTATCAGTTTATCATGGAGCGATTTCCCTATTATAGAGAA
AACAAACAAGGATGGCAAAATTCTATAAGACACAACTTAAGCCTCAACGAGTGTTTTGTT
AAAGTAGCCAGAGACGATAAAAAACCTGGTAAAGGTAGTTATTGGACATTAGACCCAGAT
TCGTATAACATGTTCGATAACGGTTCATATCTAAGGCGGCGGCGCCGTTTCAAGAAAAAA
GATGCTTTAAAGGAAAAAGAAGAAGCACTTAAGCGACAACAGCAACTTCAACAAGCACAG
GAGGCGCTCGCCGCACAAGAAGCGTTATCGGCAGCTGATGCTCTCGGACAGCAACGTGAC
GTCAAACCTGATGTAAAACCACGGATTTTTGAGTGCCGACCGAAGAGGGAACCCGGCGCA
GAATGCACAAGATACGATAAGCCAGTAGA
(749 bp)

- SilkBase 1999-2023 -