SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoBR_DN10500_c0_g1_i1
Scaffold_idBomo_Chr8
NCBI non-redundant
(nr)		LOW_QUALITY_PROTEIN:_histone_deacetylase_4_[Bombyx_mori]
Ontology
GO:0000118 C histone deacetylase complex
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0001975 P response to amphetamine
GO:0003714 F transcription corepressor activity
GO:0004407 F histone deacetylase activity
GO:0005080 F protein kinase C binding
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005667 C transcription regulator complex
GO:0005737 C cytoplasm
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006954 P inflammatory response
GO:0007507 P heart development
GO:0008134 F transcription factor binding
GO:0016568 P chromatin organization
GO:0016575 P histone deacetylation
GO:0016787 F hydrolase activity
GO:0030182 P neuron differentiation
GO:0030183 P B cell differentiation
GO:0032041 F NAD-dependent histone deacetylase activity (H3-K14 specific)
GO:0032869 P cellular response to insulin stimulus
GO:0033558 F protein deacetylase activity
GO:0034983 P peptidyl-lysine deacetylation
GO:0035097 C histone methyltransferase complex
GO:0042113 P B cell activation
GO:0042826 F histone deacetylase binding
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0046872 F metal ion binding
GO:0048742 P regulation of skeletal muscle fiber development
GO:0051153 P regulation of striated muscle cell differentiation
GO:0070491 F DNA-binding transcription factor binding
GO:0070932 P histone H3 deacetylation
GO:0070933 P histone H4 deacetylation
GO:0090050 P positive regulation of cell migration involved in sprouting angiogenesis
Transcript
Level		FPKM:0.00 TPM:0.00
ORF Entry
Sequence
(Nucleotide)
CCACGCCCGCGCCGTCGCGCCCCCGCCCCGCGAACACCTGCACGTGCGCCTCCGTGTGCA
CGCTCTGCAGTTCGTCGAGCGTGGCCTTCCTGGGCCGCGTGCGCTCGGTGCGGGCGGCCA
GGCCGGTCTCGCACAGGCGCGCCCACACGGACTGCAGGCGGCCGCCGTGCTCCGGGTGCG
TGGGGGCGTGCTGTCCGCACGCACACCCATGCTTGAGCATGAGCGGGTCGTAGGCGAGTC
CCGTGGCGGGCACCCTGGCCCCCACCAGGGGCGACGAGAGGGCGCGGGTGAG
(292 bp)

- SilkBase 1999-2023 -