SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoBR_DN10327_c0_g1_i1
Scaffold_idBomo_Chr5
NCBI non-redundant
(nr)		LOW_QUALITY_PROTEIN:_adenylate_cyclase_type_1-like,_partial_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0003091 P renal water homeostasis
GO:0004016 F adenylate cyclase activity
GO:0005516 F calmodulin binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006171 P cAMP biosynthetic process
GO:0007189 P adenylate cyclase-activating G protein-coupled receptor signaling pathway
GO:0007190 P activation of adenylate cyclase activity
GO:0007193 P adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway
GO:0007409 P axonogenesis
GO:0007616 P long-term memory
GO:0007623 P circadian rhythm
GO:0008294 F calcium- and calmodulin-responsive adenylate cyclase activity
GO:0009190 P cyclic nucleotide biosynthetic process
GO:0010226 P response to lithium ion
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016829 F lyase activity
GO:0016849 F phosphorus-oxygen lyase activity
GO:0019933 P cAMP-mediated signaling
GO:0034199 P activation of protein kinase A activity
GO:0035556 P intracellular signal transduction
GO:0042493 P response to xenobiotic stimulus
GO:0042752 P regulation of circadian rhythm
GO:0045121 C membrane raft
GO:0046872 F metal ion binding
GO:0048511 P rhythmic process
GO:0070062 C extracellular exosome
GO:0071277 P cellular response to calcium ion
GO:0071377 P cellular response to glucagon stimulus
GO:1904322 P cellular response to forskolin
Transcript
Level		FPKM:0.00 TPM:0.00
ORF Entry
Sequence
(Nucleotide)
GTCCCAAAACATATTTCTAATGTCCTGTCTTACTTTGGATACGATGTGCTCTGGTAAAAT
ACTCATCATCAGCCGTTCTTCTTGATCCTTAACGAATTTCAATCTTAACGTACTCTCCAC
ACAGGCTCTTCTGTCCAAAAAGGACCGTCTTGTAATTATTTCGTTCATTAGCCTAAAGTA
CACGCCCATTAGATTTACGCCGATCAGATAAATTATATCTGATGCTACGACAACACCGAT
CTGTGGGTTCTGCCGATAAGTG
(262 bp)

- SilkBase 1999-2023 -