SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/04/21
 
NameA_BomoASG_c26000_g1_i2
Scaffold_idBomo_Chr8
NCBI non-redundant
(nr)
probable_ATP-dependent_RNA_helicase_DDX52_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
GO:0003723 F RNA binding
GO:0004004 F RNA helicase activity
GO:0004386 F helicase activity
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005730 C nucleolus
GO:0006364 P rRNA processing
GO:0010501 P RNA secondary structure unwinding
GO:0016020 C membrane
GO:0016787 F hydrolase activity
GO:0044822 F RNA binding
Transcript
Level
FPKM:15.13 TPM:11.61
ORF EntryO_BomoASG10007_complete:A_BomoASG_c26000_g1_i2
Sequence
(Nucleotide)
GTGCTCTTCCGATCTGTCTTTCAACATCAACACGCTATGTTTCTAAACAAACTAAATCAT
TAAATCTACATAATAATATTATTAAGTTAATAAAATGGACGCATACGATATATTCAAGAA
ATTAACGAAAGGATTGTCATTTAAAAAACCTGTGTTGGGTGTTAAAAACAATCAACAGAA
AACTAAACAGGAGACCTTAAAACAAGAAATTGAAATCAAGAAGGAAGAATTGAGCGACTT
TGAAGATGTTGCGGAAATTGAGAATGATTTGGAAAACTCCCAACCAAGTTCTGGAAGCGA
GGAAGAAGAATTGGAGCTAGTTGATGGTGTTAAAGTTGGTAAAAAAAAGCGGGGAAAGAA
AAAGAAGGAAATAACCGAAGATTTAAAGAAGAAACTGTTACAAGAGGAGGAAAATCGTTT
TCGTAATGAACATGGTATCAAAGCAGTCGGCCGACACATACCACCAGCACTAAAAGACTT
TTCGGACTTGACTGTCCGTTACAATGTTCCACAGGCTCTTGTTGATACAGTCACCCAGTG
TGGATACAGTGAACCCACTCCAGTTCAACGTCAAGCAATGGCTTGCATGTTGGAGGACCG
TCAAATAGTAGCATGCGCTCCTACGGGGTCGGGTAAAACTGCCGCGTTTATCGTACCCCT
CCTTCATACATTAGGAACGCACCAAGGCGGTCCTAGAGCCCTAATACTGTGCCCTACTAG
GGAACTGGCTCATCAAATATACAGGGAGGCCCTACGGCTGAGTGCCTCAACTCAACTTAG
AGTTACAGTTGTGAAGAATTTGAAAGAAAGTAAAGTTAAAGAACGCGAAGCTACCTTCCG
GAAAAGCGATATAGTTATAAGTACACCAAATCGACTCTGCTATCTACTGAATCAAGATCA
AGTTAATATTTCTTTAGAGAAAGTACGCTGGCTTATAATCGACGAGGCCGACAAGCTGTT
CGAGGGCTCCTCAGAGCAGGAATCCGACTTCAGGCAGCAGCTGGAGCAGATAATGTGCCG
CTGTGGACCGAAACGCCTCATCGCCATGTTCAGCGCCACGCACACGCCGCCCGTCGCCCG
CTGGAGCCGCCGCCACCTGCGCGGGCTCGTCAACGTCACCGTGGGACACAGGAACGCTGC
GACGAGCCTGGTGGAGCAGCAGCTGCTGTACTGCGGCAACGAGGATGGCAAGCTGGTGGC
GTTCCGGCAGCTCGTGCAGCAAGGACTCAAGCCCCCCGTACTAGTCTTCGTACAAAGTAA
AGATCGCGCGAAACAATTGTTCAAGGAACTCATATATGACGGCATCAACGTGGACGTCAT
ACACGCAGACAGGACTCAGGCTCAGCGAGACAACGTGGTCCGCAGCTTCCGCGTGGGACG
TATATGGGTCCTGATCAGCACCGAACTGATGGGCCGCGGGATCGACTTCCGGGGAGTGAA
TCTGGTCATCAACTACGACTTCCCACCCTCAGCTATATCTTACGTACACAGGATCGGGCG
TGCGGGCCGGGCCGGTCACAGGGGGAGGGCTGTGACGTTCTTCACGCAGGACGACGTCGT
CAACTTGAGGAGCATCGCGTCGGTGATGAAGCAGTCCGGCTGCGAGGTCCCGGAGTACAT
GCTGAGGCTGAAGCAAGACTCCAACAAGCGAAAACGGCTGCTCAAGAAGGCTCCGCATCG
AGATAAAATATCCACTATACTAGAGAAGCCGGTCAAAAGGAAATTAGAAGAAGGAAAGGA
TTCTAATGTAAATTCAAAAGATACAGAGAAGATAAAGAACGGTAAACACAAGAAGCAAAG
GAAAATTGATGGAACAAAAGAAAATGGCGCTCGCAGAAGTACGAGCGAGAAGGAGAATAA
AAGGAAAAAATTTAAAAAGAATAAAAAGATTAAATTAACCAAAAAACCTAAATCTGGAAG
TTGATAATATAAATAAATGTACAATAGTCATTGAACAAAAAAAAA
(1965 bp)

- SilkBase 1999-2022 -