SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomoASG_c13660_g1_i1
Scaffold_idBomo_Chr11
NCBI non-redundant
(nr)		cell_division_cycle_25_isoform_X1_[Bombyx_mori]
Ontology
GO:0000086 P G2/M transition of mitotic cell cycle
GO:0000278 P mitotic cell cycle
GO:0004721 F phosphoprotein phosphatase activity
GO:0004725 F protein tyrosine phosphatase activity
GO:0004726 F non-membrane spanning protein tyrosine phosphatase activity
GO:0005622 C intracellular anatomical structure
GO:0005634 C nucleus
GO:0005694 C chromosome
GO:0006470 P protein dephosphorylation
GO:0007030 P Golgi organization
GO:0007049 P cell cycle
GO:0007067 P mitotic cell cycle
GO:0007088 P regulation of mitotic nuclear division
GO:0007099 P centriole replication
GO:0007346 P regulation of mitotic cell cycle
GO:0007369 P gastrulation
GO:0007422 P peripheral nervous system development
GO:0007424 P open tracheal system development
GO:0007488 P histoblast morphogenesis
GO:0007498 P mesoderm development
GO:0008138 F protein tyrosine/serine/threonine phosphatase activity
GO:0008283 P cell population proliferation
GO:0008284 P positive regulation of cell population proliferation
GO:0016787 F hydrolase activity
GO:0035335 P peptidyl-tyrosine dephosphorylation
GO:0045792 P negative regulation of cell size
GO:0045930 P negative regulation of mitotic cell cycle
GO:0045931 P positive regulation of mitotic cell cycle
GO:0045977 P positive regulation of mitotic cell cycle, embryonic
GO:0046331 P lateral inhibition
GO:0051301 P cell division
GO:0060305 P regulation of cell diameter
Transcript
Level		FPKM:8.34 TPM:6.40
ORF Entry
Sequence
(Nucleotide)
CCGCTGTCCCCGAGGAAATCCGACGGGAAGCGGAGCATCCTGGTCTTCCACTGCGAATTC
TCATTGGAACGGGGACCTAAACTGTCCCGCTTCCTGCGCTCGTCGGACCGCGAGAGCAAC
AAGGAGCGCTACCCGGCGCTGCGCTTCCCCGAGGTGTACCTGCTGCACGAGGGCTACCGG
CGCTTCTACCAGAAGTACCCCGAGCTGTGCTCCCCCACCGG
(221 bp)

- SilkBase 1999-2023 -