SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c22757_g1_i2
Scaffold_id
NCBI non-redundant
(nr)		uncharacterized_protein_LOC101743084_isoform_X2_[Bombyx_mori]
Ontology
GO:0001505 P regulation of neurotransmitter levels
GO:0001932 P regulation of protein phosphorylation
GO:0001933 P negative regulation of protein phosphorylation
GO:0001934 P positive regulation of protein phosphorylation
GO:0005109 F frizzled binding
GO:0005515 F protein binding
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005874 C microtubule
GO:0005886 C plasma membrane
GO:0006366 P transcription by RNA polymerase II
GO:0006469 P negative regulation of protein kinase activity
GO:0007269 P neurotransmitter secretion
GO:0007275 P multicellular organism development
GO:0007409 P axonogenesis
GO:0007411 P axon guidance
GO:0007416 P synapse assembly
GO:0007528 P neuromuscular junction development
GO:0008013 F beta-catenin binding
GO:0010976 P positive regulation of neuron projection development
GO:0015630 C microtubule cytoskeleton
GO:0016020 C membrane
GO:0016023 C cytoplasmic vesicle
GO:0016055 P Wnt signaling pathway
GO:0016328 C lateral plasma membrane
GO:0019899 F enzyme binding
GO:0019901 F protein kinase binding
GO:0021915 P neural tube development
GO:0022007 P convergent extension involved in neural plate elongation
GO:0030136 C clathrin-coated vesicle
GO:0030177 P positive regulation of Wnt signaling pathway
GO:0030424 C axon
GO:0030425 C dendrite
GO:0030426 C growth cone
GO:0031122 P cytoplasmic microtubule organization
GO:0031410 C cytoplasmic vesicle
GO:0032091 P negative regulation of protein binding
GO:0032436 P positive regulation of proteasomal ubiquitin-dependent protein catabolic process
GO:0034504 P protein localization to nucleus
GO:0035176 P social behavior
GO:0035372 P protein localization to microtubule
GO:0035556 P intracellular signal transduction
GO:0042802 F identical protein binding
GO:0043005 C neuron projection
GO:0043025 C neuronal cell body
GO:0043113 P receptor clustering
GO:0045202 C synapse
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0048365 F small GTPase binding
GO:0048668 P collateral sprouting
GO:0048675 P axon extension
GO:0048813 P dendrite morphogenesis
GO:0050808 P synapse organization
GO:0050821 P protein stabilization
GO:0060029 P convergent extension involved in organogenesis
GO:0060070 P canonical Wnt signaling pathway
GO:0060071 P Wnt signaling pathway, planar cell polarity pathway
GO:0060134 P prepulse inhibition
GO:0071340 P skeletal muscle acetylcholine-gated channel clustering
GO:0090090 P negative regulation of canonical Wnt signaling pathway
GO:0090103 P cochlea morphogenesis
GO:0090179 P planar cell polarity pathway involved in neural tube closure
GO:0090263 P positive regulation of canonical Wnt signaling pathway
GO:0098793 C presynapse
GO:1902474 P positive regulation of protein localization to synapse
GO:1903827 P regulation of protein localization
GO:1904886 P beta-catenin destruction complex disassembly
GO:1990909 C Wnt signalosome
Transcript
Level		FPKM:3.19 TPM:1.43
ORF EntryO_BomaMSG12897_5prime_partial:A_BomaMSG_c22757_g1_i2
Sequence
(Nucleotide)
AGATCGGAAGAGCGTCGGGACGCGCCCAACTTGTACCAAGAGAACATGAGCAAGCAAAGG
TACACGGAGTTCCCAGCGGAATCACTCGAGCCGGTTTCGATGCCCGTCATCTCGGAAGAA
GCGCGATTCCAACACACCAATCCCGCCTACCAGAGCGCTGTACTACACGGCGCAGACACC
GTGACTAGCGAAGGTCTTAACGACGATGGAAAAGGACTACATAAATGGAAAGGCGTGGCG
CTCTCGCCTGATAACGAGAGGAAAGTGAAGACAGACTCAATTCAAAATCAACGCAAACCT
CCGATTGTAATCGATGCTGCCCAAAAAGAAAACGTAAAACCCGAGACCACAAATGACGTC
ACAAACACAGAACCCACGATAGTGACTGTAGAACTGAACCGAGGCTGGAACAGTAGACTC
GGCTTCAGCGTGCAGAGTCATCCTGAATCCGGACAGAGCTACATCTCCGCTGTTTACAAC
GACAGCGTGGCCGCCAGGGACGGCCGCCTTCAGCGTGGAGACGTTATATTACAGGTTAAC
GATGAAAACGTTACATCAATGAAAACGCCGGAAGTAATCGATTTGCTGAGAATCCTCCGG
GGATCTATCTGCATTACAGTTTTGCGGCCGCCTAACCCGTAATATTGGTTGACTTTTTAT
TGCAAATTAGGAAAACTTCTTGGAATGGGAAACTCACACATTTTTCTGAAAATCTTTATA
AAAACTAGCAAACATTATCGATACATTCTAAATAGTCTGTCCTAAGTTAATCAGGGCAGT
TATTACTAAAATTCAC
(796 bp)

- SilkBase 1999-2023 -