SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c22102_g1_i4
Scaffold_id
NCBI non-redundant
(nr)		HMG_box-containing_protein_4_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000981 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0001228 F DNA-binding transcription activator activity, RNA polymerase II-specific
GO:0001525 P angiogenesis
GO:0001570 P vasculogenesis
GO:0001706 P endoderm formation
GO:0001828 P inner cell mass cellular morphogenesis
GO:0001947 P heart looping
GO:0003142 P cardiogenic plate morphogenesis
GO:0003143 P embryonic heart tube morphogenesis
GO:0003151 P outflow tract morphogenesis
GO:0003308 P negative regulation of Wnt signaling pathway involved in heart development
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0003705 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0003713 F transcription coactivator activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005667 C transcription regulator complex
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007283 P spermatogenesis
GO:0007369 P gastrulation
GO:0007492 P endoderm development
GO:0007493 P endodermal cell fate determination
GO:0008013 F beta-catenin binding
GO:0008134 F transcription factor binding
GO:0010628 P positive regulation of gene expression
GO:0016055 P Wnt signaling pathway
GO:0021903 P rostrocaudal neural tube patterning
GO:0023019 P signal transduction involved in regulation of gene expression
GO:0030178 P negative regulation of Wnt signaling pathway
GO:0030308 P negative regulation of cell growth
GO:0031648 P protein destabilization
GO:0035050 P embryonic heart tube development
GO:0042074 P cell migration involved in gastrulation
GO:0042661 P regulation of mesodermal cell fate specification
GO:0042662 P negative regulation of mesodermal cell fate specification
GO:0042789 P mRNA transcription by RNA polymerase II
GO:0043565 F sequence-specific DNA binding
GO:0044212 F transcription cis-regulatory region binding
GO:0044798 C transcription regulator complex
GO:0045595 P regulation of cell differentiation
GO:0045597 P positive regulation of cell differentiation
GO:0045732 P positive regulation of protein catabolic process
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0045995 P regulation of embryonic development
GO:0046982 F protein heterodimerization activity
GO:0048568 P embryonic organ development
GO:0048617 P embryonic foregut morphogenesis
GO:0048643 P positive regulation of skeletal muscle tissue development
GO:0048863 P stem cell differentiation
GO:0048866 P stem cell fate specification
GO:0050821 P protein stabilization
GO:0060070 P canonical Wnt signaling pathway
GO:0060214 P endocardium formation
GO:0060807 P obsolete regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification
GO:0060913 P cardiac cell fate determination
GO:0060956 P endocardial cell differentiation
GO:0061009 P common bile duct development
GO:0061010 P gall bladder development
GO:0061031 P endodermal digestive tract morphogenesis
GO:0072001 P renal system development
GO:0072091 P regulation of stem cell proliferation
GO:0090090 P negative regulation of canonical Wnt signaling pathway
GO:2000035 P regulation of stem cell division
GO:2000043 P regulation of cardiac cell fate specification
Transcript
Level		FPKM:0.00 TPM:0.00
ORF EntryO_BomaMSG11591_3prime_partial:A_BomaMSG_c22102_g1_i4
Sequence
(Nucleotide)
GCTAATTGTGAAGGATGGCGAAACTAATTGTGAAGGATGGCCGAGTTATTGGCAGGGCTA
AAGCTCAGAGAAAAGATAAAGGAAAAACACGCATTACAGCCTATATGATGTGGGCGAAAG
AGGCCCGTAATGAACTGCTTAAGAAACATCCCGACATGGATTTCTCGGCTATATCAAAAC
GACTTGGAGAAATGTGGTCTAATGTGAATTACAACGAGAGATACTTGTGGAAGCGCAAAG
CTAAGAGATTCGCCATACAGAAGGAGCAAAACAATCAAGTTATCAACAAAATCATATCCA
ATCCGAGTGTGAGGCCGGCGAACCCCGGGCCGGGCCGTCCATCCGTCGGGCGCCCCCCGC
GCACCCCCGC
(370 bp)

- SilkBase 1999-2023 -