SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c1277_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		vang-like_protein_1_[Bombyx_mori]
Ontology
GO:0000132 P establishment of mitotic spindle orientation
GO:0000902 P cell morphogenesis
GO:0001654 P eye development
GO:0001736 P establishment of planar polarity
GO:0001756 P somitogenesis
GO:0001764 P neuron migration
GO:0001839 P neural plate morphogenesis
GO:0001841 P neural tube formation
GO:0003401 P axis elongation
GO:0005515 F protein binding
GO:0005886 C plasma membrane
GO:0007015 P actin filament organization
GO:0007163 P establishment or maintenance of cell polarity
GO:0007275 P multicellular organism development
GO:0007369 P gastrulation
GO:0007399 P nervous system development
GO:0014812 P muscle cell migration
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016055 P Wnt signaling pathway
GO:0021535 P cell migration in hindbrain
GO:0021915 P neural tube development
GO:0030010 P establishment of cell polarity
GO:0030111 P regulation of Wnt signaling pathway
GO:0030154 P cell differentiation
GO:0030198 P extracellular matrix organization
GO:0030903 P notochord development
GO:0035844 P cloaca development
GO:0036342 P post-anal tail morphogenesis
GO:0042074 P cell migration involved in gastrulation
GO:0042384 P cilium assembly
GO:0044782 P cilium organization
GO:0045813 P positive regulation of Wnt signaling pathway, calcium modulating pathway
GO:0048048 P embryonic eye morphogenesis
GO:0048570 P notochord morphogenesis
GO:0048840 P otolith development
GO:0055002 P striated muscle cell development
GO:0060026 P convergent extension
GO:0060027 P convergent extension involved in gastrulation
GO:0060030 P dorsal convergence
GO:0060070 P canonical Wnt signaling pathway
GO:0060071 P Wnt signaling pathway, planar cell polarity pathway
GO:0060972 P left/right pattern formation
GO:0097475 P motor neuron migration
Transcript
Level		FPKM:0.55 TPM:0.25
ORF Entry
Sequence
(Nucleotide)
GATGCAACAGATTACAAAGCTCTTGTTACATATGTATCGAGTTTTGCAGATACATTGCTC
TTCATACATTATGTAGCAGTAATCTTGATAGAAATAAGACATTTAGAGCCGAATTATTAT
ATTAAAATCGTCAGAAGTCCTGATGGAGAGAGTAGATCATATGCAATAGGTCAATTAAGC
ATCCAAAGAGCTGCAGTATGGGTATTACAGAGGTATTATACTGAGTTTCCGATATATAAC
CCATATCTGGAGAAGATACCAATATCGAAGAG
(272 bp)

- SilkBase 1999-2023 -