SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c11646_g1_i2
Scaffold_id
NCBI non-redundant
(nr)		DNA_cytosine-5_methyltransferase_isoform_X1_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000792 C heterochromatin
GO:0003677 F DNA binding
GO:0003682 F chromatin binding
GO:0003723 F RNA binding
GO:0003886 F DNA (cytosine-5-)-methyltransferase activity
GO:0005634 C nucleus
GO:0005657 C replication fork
GO:0005721 C pericentric heterochromatin
GO:0006306 P DNA methylation
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007265 P Ras protein signal transduction
GO:0008168 F methyltransferase activity
GO:0008270 F zinc ion binding
GO:0008327 F methyl-CpG binding
GO:0009008 F DNA-methyltransferase activity
GO:0010216 P maintenance of DNA methylation
GO:0010468 P regulation of gene expression
GO:0010628 P positive regulation of gene expression
GO:0016458 P obsolete gene silencing
GO:0016568 P chromatin organization
GO:0016740 F transferase activity
GO:0032259 P methylation
GO:0042127 P regulation of cell population proliferation
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0046872 F metal ion binding
GO:0051571 P positive regulation of histone H3-K4 methylation
GO:0051573 P negative regulation of histone H3-K9 methylation
GO:0071230 P cellular response to amino acid stimulus
GO:0090116 P C-5 methylation of cytosine
GO:0090309 P positive regulation of DNA methylation-dependent heterochromatin assembly
GO:1990841 F promoter-specific chromatin binding
Transcript
Level		FPKM:0.00 TPM:0.00
ORF Entry
Sequence
(Nucleotide)
GGAGATTCCATTTTCGACCGTCGTTGGGCATTGTCATTTAATTTATGAACAAAATGTTCC
CCAAAATATTTCACTTCAAGAATGGTTAGGAAGTGATCCGTGCAGATTCTACTTCAGAAT
GGCGTATTGTAAGTCCACGGGAGAGTTCACGGATGTCCCGCAGAATGCCATCAGTGTTGG
AAGAATAGATCGTACTAAAGATAAGGGAAGGGGAGATCGGAAGAGCGT
(228 bp)

- SilkBase 1999-2023 -