SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c115_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		protein_kinase_C_[Bombyx_mori]
Ontology
GO:0000165 P MAPK cascade
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0004697 F protein kinase C activity
GO:0005524 F ATP binding
GO:0005622 C intracellular anatomical structure
GO:0005623 C obsolete cell
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005856 C cytoskeleton
GO:0006468 P protein phosphorylation
GO:0006935 P chemotaxis
GO:0007218 P neuropeptide signaling pathway
GO:0007269 P neurotransmitter secretion
GO:0007606 P sensory perception of chemical stimulus
GO:0007635 P chemosensory behavior
GO:0008306 P associative learning
GO:0016020 C membrane
GO:0016079 P synaptic vesicle exocytosis
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0018105 P peptidyl-serine phosphorylation
GO:0035556 P intracellular signal transduction
GO:0040012 P regulation of locomotion
GO:0040024 P dauer larval development
GO:0045202 C synapse
GO:0046872 F metal ion binding
GO:0048009 P insulin-like growth factor receptor signaling pathway
GO:0050893 P sensory processing
GO:0050920 P regulation of chemotaxis
GO:0050927 P positive regulation of positive chemotaxis
GO:0050975 P sensory perception of touch
GO:0098793 C presynapse
GO:1902074 P response to salt
GO:1990504 P dense core granule exocytosis
GO:2001024 P negative regulation of response to drug
Transcript
Level		FPKM:7.29 TPM:3.26
ORF Entry
Sequence
(Nucleotide)
CTCTAAGGGTTCATGACGAAGGCGCCGAGCCGGCGGCTGGGCGTGTGCGGCGGCGCGGCG
GGTATCAAGGCGCACGCGTTCTTCCGCGACGTGGACTGGGACGCGCTCGCCCAGAGGAAG
CTGCGGCCGCCCTTCCGCCCCAAGAAGAGCAAGCGCGAGGCCGTCAACTTCGACGCGGAG
TTCACCAAGGAGGAGCCCGTGCTCACGCCCGTCGCGCCAGACGTGCTGCGGACCATCAAC
C
(241 bp)

- SilkBase 1999-2023 -