SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c11503_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		nonfunctional_doublesex_M4_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000398 P mRNA splicing, via spliceosome
GO:0000987 F cis-regulatory region sequence-specific DNA binding
GO:0001077 F DNA-binding transcription activator activity, RNA polymerase II-specific
GO:0001078 F DNA-binding transcription repressor activity, RNA polymerase II-specific
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0003729 F mRNA binding
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006357 P regulation of transcription by RNA polymerase II
GO:0006366 P transcription by RNA polymerase II
GO:0007283 P spermatogenesis
GO:0007417 P central nervous system development
GO:0007483 P genital disc morphogenesis
GO:0007485 P imaginal disc-derived male genitalia development
GO:0007486 P imaginal disc-derived female genitalia development
GO:0007530 P sex determination
GO:0007548 P sex differentiation
GO:0007619 P courtship behavior
GO:0008049 P male courtship behavior
GO:0008270 F zinc ion binding
GO:0016199 P axon midline choice point recognition
GO:0018993 P somatic sex determination
GO:0019101 P female somatic sex determination
GO:0019102 P male somatic sex determination
GO:0030154 P cell differentiation
GO:0035215 P genital disc development
GO:0035263 P genital disc sexually dimorphic development
GO:0042803 F protein homodimerization activity
GO:0043565 F sequence-specific DNA binding
GO:0045433 P male courtship behavior, veined wing generated song production
GO:0045496 P male analia development
GO:0045497 P female analia development
GO:0045498 P sex comb development
GO:0045570 P regulation of imaginal disc growth
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046660 P female sex differentiation
GO:0046661 P male sex differentiation
GO:0046872 F metal ion binding
GO:0048071 P sex-specific pigmentation
GO:0048086 P negative regulation of developmental pigmentation
Transcript
Level		FPKM:6.75 TPM:3.01
ORF Entry
Sequence
(Nucleotide)
CTTCCGATCTGTTCCTCATGCCCCTCCTAACTGTGCGCGCTGCCGCAATCACAGGCTCAA
GATCGAGCTCAAGGGTCACAAGCGGTACTGCAAATATCAGCACTGCACTTGTGAAAAGTG
CCGCCTTACCGCAGACAGGCAGCGGGTAATGGCAAAGCAAACGGCAATCAGACGGGCCCA
GGCTCAGGACGAAGCGCGTGCGCGTGCGCTGGAATTAGGAATACAGCC
(228 bp)

- SilkBase 1999-2023 -