SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c11381_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		zinc_finger_protein_26-like_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000790 C chromatin
GO:0001078 F DNA-binding transcription repressor activity, RNA polymerase II-specific
GO:0001649 P osteoblast differentiation
GO:0001837 P epithelial to mesenchymal transition
GO:0003198 P epithelial to mesenchymal transition involved in endocardial cushion formation
GO:0003273 P cell migration involved in endocardial cushion formation
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0003682 F chromatin binding
GO:0003705 F DNA-binding transcription factor activity, RNA polymerase II-specific
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006933 P negative regulation of cell adhesion involved in substrate-bound cell migration
GO:0007219 P Notch signaling pathway
GO:0007275 P multicellular organism development
GO:0007605 P sensory perception of sound
GO:0009314 P response to radiation
GO:0010839 P negative regulation of keratinocyte proliferation
GO:0010957 P negative regulation of vitamin D biosynthetic process
GO:0014032 P neural crest cell development
GO:0016477 P cell migration
GO:0030335 P positive regulation of cell migration
GO:0032331 P negative regulation of chondrocyte differentiation
GO:0032642 P regulation of chemokine production
GO:0033629 P negative regulation of cell adhesion mediated by integrin
GO:0035066 P positive regulation of histone acetylation
GO:0035414 P negative regulation of canonical Wnt signaling pathway
GO:0035921 P desmosome disassembly
GO:0043066 P negative regulation of apoptotic process
GO:0043473 P pigmentation
GO:0043518 P negative regulation of DNA damage response, signal transduction by p53 class mediator
GO:0043565 F sequence-specific DNA binding
GO:0044344 P cellular response to fibroblast growth factor stimulus
GO:0045600 P positive regulation of fat cell differentiation
GO:0045667 P regulation of osteoblast differentiation
GO:0046872 F metal ion binding
GO:0050872 P white fat cell differentiation
GO:0060021 P roof of mouth development
GO:0060070 P canonical Wnt signaling pathway
GO:0060429 P epithelium development
GO:0060536 P cartilage morphogenesis
GO:0060693 P regulation of branching involved in salivary gland morphogenesis
GO:0070563 P negative regulation of vitamin D receptor signaling pathway
GO:0071364 P cellular response to epidermal growth factor stimulus
GO:0071479 P cellular response to ionizing radiation
GO:0090090 P negative regulation of canonical Wnt signaling pathway
GO:1900387 P obsolete negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter
GO:1902230 P negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage
GO:2000647 P negative regulation of stem cell proliferation
GO:2000810 P regulation of bicellular tight junction assembly
GO:2000811 P negative regulation of anoikis
GO:2001240 P negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level		FPKM:3.63 TPM:1.62
ORF EntryO_BomaMSG2817_complete:A_BomaMSG_c11381_g1_i1
Sequence
(Nucleotide)
TATATTAAGTGTATAATCTATGGTACCGTACCGTACATATTATTGGTAAAAATCCTTATT
TTACCTACTTATAAAGTTAAAAAATTATATTCAAACTTAATACCCGCAAAAAATGGCTAA
TGCTATGGAGATAATGAAACCGGCTTCTCAGTTTGTTGCTGGTGAGACTGAGCGCATCTG
TAGACTATGTTTCACTTCAACACAAAACGATGGAACTGATTTAAAAGATAGCGCTAAGCT
AGACAATTATTATTGTAACGAAGAATTAACTTTTGAGGACATGTTTCTAGAACTAGATGT
ACCTATAGAAACAGATCTACCGCAAACCCTATGCGTTAACTGTGTTTCAATGACAATAAA
TTCATATTTATTTAAAAGGTTAATAAAATACTCAGAAAGCATGTGGAATAATTTCCTGAA
TAAGCTTGATTTCAGCTTGAATCTGTCTGAGACAACTAGAGCAAATGCACAAACAATATA
TATCATTATGGGAAAAAACAATACCATACTTAAAAGCAGAAAGAAGCAAGTGACAAATAA
GAAAGAAGCATTGACTACAATTAAAGACAATATCAAAAGCAGACAGAAATATGTCAAGGT
CAAAAACAAAAATGTCACCTGTGATGATTGCGGGGAGAGGTTCAAAGCAAAATGGATGTT
AAAGCGACACATGAAGAACCGTTGTAGCACAAAATGTTCATGTCCTCAATGTCCCAAAGA
TTTTTCTACATATTCCTTATTAAAAGGACACATTGAAAGAATGCATCATCCAAAACGAAT
TAAATGCAAAAAATGCCCAAAAATGTTCAGCACTGAGAAATTACTACATAGACATGACAA
AATGTACCACTTAGCAGCCATATGCAAACTGTGTTTTGTGCAATTCCCCAC
(891 bp)

- SilkBase 1999-2023 -