SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c10362_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		carboxylesterase_clade_H,_member_1_precursor_[Bombyx_mori]
Ontology
GO:0002087 P regulation of respiratory gaseous exchange by nervous system process
GO:0004872 F signaling receptor activity
GO:0005615 C extracellular space
GO:0005794 C Golgi apparatus
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006605 P protein targeting
GO:0007155 P cell adhesion
GO:0007157 P heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules
GO:0007158 P neuron cell-cell adhesion
GO:0007399 P nervous system development
GO:0007416 P synapse assembly
GO:0009897 C external side of plasma membrane
GO:0009986 C cell surface
GO:0010841 P positive regulation of circadian sleep/wake cycle, wakefulness
GO:0014069 C postsynaptic density
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016080 P synaptic vesicle targeting
GO:0016339 P calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules
GO:0017146 C NMDA selective glutamate receptor complex
GO:0023041 P neuronal signal transduction
GO:0030054 C cell junction
GO:0030165 F PDZ domain binding
GO:0030425 C dendrite
GO:0031175 P neuron projection development
GO:0032230 P positive regulation of synaptic transmission, GABAergic
GO:0032433 C filopodium tip
GO:0035418 P protein localization to synapse
GO:0042043 F neurexin family protein binding
GO:0043197 C dendritic spine
GO:0043198 C dendritic shaft
GO:0045184 P establishment of protein localization
GO:0045202 C synapse
GO:0045211 C postsynaptic membrane
GO:0045664 P regulation of neuron differentiation
GO:0046983 F protein dimerization activity
GO:0048489 P synaptic vesicle transport
GO:0048511 P rhythmic process
GO:0048789 P cytoskeletal matrix organization at active zone
GO:0050804 P modulation of chemical synaptic transmission
GO:0050808 P synapse organization
GO:0050839 F cell adhesion molecule binding
GO:0051260 P protein homooligomerization
GO:0051290 P protein heterotetramerization
GO:0051491 P positive regulation of filopodium assembly
GO:0051965 P positive regulation of synapse assembly
GO:0051968 P positive regulation of synaptic transmission, glutamatergic
GO:0052689 F carboxylic ester hydrolase activity
GO:0060076 C excitatory synapse
GO:0060291 P long-term synaptic potentiation
GO:0060999 P positive regulation of dendritic spine development
GO:0061002 P negative regulation of dendritic spine morphogenesis
GO:0072553 P terminal button organization
GO:0097091 P synaptic vesicle clustering
GO:0097104 P postsynaptic membrane assembly
GO:0097105 P presynaptic membrane assembly
GO:0097110 F scaffold protein binding
GO:0097113 P AMPA glutamate receptor clustering
GO:0097114 P NMDA glutamate receptor clustering
GO:0097115 P neurexin clustering involved in presynaptic membrane assembly
GO:0097119 P postsynaptic density protein 95 clustering
GO:0097120 P receptor localization to synapse
GO:0097481 C postsynaptic density
GO:0098793 C presynapse
GO:1900029 P positive regulation of ruffle assembly
GO:1900244 P positive regulation of synaptic vesicle endocytosis
GO:1902474 P positive regulation of protein localization to synapse
GO:1902533 P positive regulation of intracellular signal transduction
GO:2000302 P positive regulation of synaptic vesicle exocytosis
GO:2000310 P regulation of NMDA receptor activity
GO:2000311 P regulation of AMPA receptor activity
GO:2000463 P positive regulation of excitatory postsynaptic potential
GO:2000809 P positive regulation of synaptic vesicle clustering
Transcript
Level		FPKM:3.13 TPM:1.40
ORF EntryO_BomaMSG2324_5prime_partial:A_BomaMSG_c10362_g1_i1
Sequence
(Nucleotide)
CTTAGGATCTTTAGGATACCTTAGTACTGATGAAAGAGATGCAGCTGGAAACGTTGGTTT
ATTTGACCTACATGCTGTAATGGCCTGGATTCAAGACTATATAACGTTTTTTGGTGGTGA
TCCAACTCGAGTTGTTGTAATGGGCCAAGGTTCGGGTGGGAGCGCTGCATCACTTTTAGC
AATGTCAGCGGAAGGACGTACCGCGACTGGTGTCGCTGCGTTATCAGGTGCTCCTCTATC
ACCAGGGGCAGTTAGACCTGAACCAGCTAAACACGCCGATACCATAGCAGAACGTACTGG
ATGCCCAAAGAGACCTGCAGAGAGTCTTATTAAGTGCCTTCGACAGGTACCCGTGGAAAA
ACTAATTATGGCCGATGAAGACTTAAGCATGGATAATGCTATGGACACAATGAAGTTTTT
GGATGAAATATCTGGACGCTCAGGTGCTGGAGCTCGCGTAGAAGGTGAGGATGACAAACG
AGCCTTGCCACCAATTGTATCGGAGAAACCGGCTGATTCTTTAAAAAAGAAAACGAAAAG
ACAGATCGGAAGAGCGTC
(558 bp)

- SilkBase 1999-2023 -