SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c10248_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		tyrosine-protein_kinase_Btk29A_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004715 F non-membrane spanning protein tyrosine kinase activity
GO:0005102 F signaling receptor binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
GO:0005886 C plasma membrane
GO:0006468 P protein phosphorylation
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007254 P JNK cascade
GO:0007300 P ovarian nurse cell to oocyte transport
GO:0007301 P female germline ring canal formation
GO:0007349 P cellularization
GO:0007391 P dorsal closure
GO:0007424 P open tracheal system development
GO:0007435 P salivary gland morphogenesis
GO:0007476 P imaginal disc-derived wing morphogenesis
GO:0007485 P imaginal disc-derived male genitalia development
GO:0007619 P courtship behavior
GO:0008258 P head involution
GO:0008340 P determination of adult lifespan
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0030036 P actin cytoskeleton organization
GO:0030717 P oocyte karyosome formation
GO:0030723 P ovarian fusome organization
GO:0030833 P regulation of actin filament polymerization
GO:0031234 C extrinsic component of cytoplasmic side of plasma membrane
GO:0035277 P spiracle morphogenesis, open tracheal system
GO:0035556 P intracellular signal transduction
GO:0038083 P peptidyl-tyrosine autophosphorylation
GO:0042023 P DNA endoreduplication
GO:0042127 P regulation of cell population proliferation
GO:0044719 P regulation of imaginal disc-derived wing size
GO:0045087 P innate immune response
GO:0045172 C germline ring canal
GO:0045177 C apical part of cell
GO:0046872 F metal ion binding
GO:0046960 P sensitization
GO:0048477 P oogenesis
GO:0071944 C cell periphery
Transcript
Level		FPKM:8.26 TPM:3.69
ORF Entry
Sequence
(Nucleotide)
GACGACTTCATCGACGAAGCTAAAGTTATGACTAAACTTCAGCACCAGAACCTGGTGCAG
CTGTACGGCGTGTGCTCCAAGCACCGGCCCATCTACATCGTGACGGAGTTCATGCGCCAC
GGCTCGCTGTTCAACTACCTGCGCCGCACGTCGCCCGACCAGCTCGGCCACGCCGTCCTC
CTCGACATGTGCATACAGGTTTGCAGAGGGATGGCGTACTTAGAAAGGCATAACTACATT
CACCGAGATCTGGCC
(255 bp)

- SilkBase 1999-2023 -