SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMSG_c10237_g2_i1
Scaffold_id
NCBI non-redundant
(nr)		xanthine_dehydrogenase_[Bombyx_mori]
Ontology
GO:0001933 P negative regulation of protein phosphorylation
GO:0001937 P negative regulation of endothelial cell proliferation
GO:0003824 F catalytic activity
GO:0004854 F xanthine dehydrogenase activity
GO:0004855 F xanthine oxidase activity
GO:0005506 F iron ion binding
GO:0005576 C extracellular region
GO:0005615 C extracellular space
GO:0005737 C cytoplasm
GO:0005777 C peroxisome
GO:0005829 C cytosol
GO:0006195 P purine nucleotide catabolic process
GO:0006919 P activation of cysteine-type endopeptidase activity involved in apoptotic process
GO:0007595 P lactation
GO:0009055 F electron transfer activity
GO:0009115 P xanthine catabolic process
GO:0010629 P negative regulation of gene expression
GO:0016491 F oxidoreductase activity
GO:0016529 C sarcoplasmic reticulum
GO:0016614 F oxidoreductase activity, acting on CH-OH group of donors
GO:0016903 F oxidoreductase activity, acting on the aldehyde or oxo group of donors
GO:0030856 P regulation of epithelial cell differentiation
GO:0042803 F protein homodimerization activity
GO:0043546 F molybdopterin cofactor binding
GO:0045602 P negative regulation of endothelial cell differentiation
GO:0046872 F metal ion binding
GO:0050660 F flavin adenine dinucleotide binding
GO:0051536 F iron-sulfur cluster binding
GO:0051537 F 2 iron, 2 sulfur cluster binding
GO:0051898 P negative regulation of protein kinase B signaling
GO:0055114 P obsolete oxidation-reduction process
GO:1900745 P positive regulation of p38MAPK cascade
GO:1900747 P negative regulation of vascular endothelial growth factor signaling pathway
GO:2000379 P positive regulation of reactive oxygen species metabolic process
GO:2001213 P negative regulation of vasculogenesis
Transcript
Level		FPKM:8.64 TPM:3.86
ORF Entry
Sequence
(Nucleotide)
ACCGTTTAACTATTTCACATACGGTGTTGCTTGTACAGAAGTAGAAATTGACTGTCTTAG
CGGTGACCATCAAGTCCTTAGAACGGATATTGTAATGGACCTCGGTGAGAGTATCAATCC
AGCGATAGATATTGGCCAGATTGAAGGCGGTTTCATACAAGGCTACGGTTTGTTCACCAT
AGAAGAATTAATTTATTCACCCACCGGAACTTTATATTCGCGAGGG
(226 bp)

- SilkBase 1999-2023 -