SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_BomaMSG_c10206_g2_i1
Scaffold_id
NCBI non-redundant
(nr)
dorsal-ventral_patterning_protein_Sog_isoform_X1_[Bombyx_mori]
Ontology
GO:0001501 P skeletal system development
GO:0001502 P cartilage condensation
GO:0001503 P ossification
GO:0001894 P tissue homeostasis
GO:0001958 P endochondral ossification
GO:0002062 P chondrocyte differentiation
GO:0003007 P heart morphogenesis
GO:0005201 F extracellular matrix structural constituent
GO:0005576 C extracellular region
GO:0005578 C extracellular matrix
GO:0005581 C collagen trimer
GO:0005585 C collagen type II trimer
GO:0005604 C basement membrane
GO:0005615 C extracellular space
GO:0005737 C cytoplasm
GO:0006029 P proteoglycan metabolic process
GO:0007417 P central nervous system development
GO:0007601 P visual perception
GO:0007605 P sensory perception of sound
GO:0010468 P regulation of gene expression
GO:0030199 P collagen fibril organization
GO:0030903 P notochord development
GO:0031012 C extracellular matrix
GO:0035108 P limb morphogenesis
GO:0042472 P inner ear morphogenesis
GO:0042802 F identical protein binding
GO:0046872 F metal ion binding
GO:0048407 F platelet-derived growth factor binding
GO:0048705 P skeletal system morphogenesis
GO:0048839 P inner ear development
GO:0051216 P cartilage development
GO:0060021 P roof of mouth development
GO:0060174 P limb bud formation
GO:0060272 P embryonic skeletal joint morphogenesis
GO:0060348 P bone development
GO:0060351 P cartilage development involved in endochondral bone morphogenesis
GO:0071599 P otic vesicle development
GO:0071773 P cellular response to BMP stimulus
GO:2001240 P negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level
FPKM:2.91 TPM:1.30
ORF Entry
Sequence
(Nucleotide)
CGATTGAGTGTTGGATATTGTAAGCAAGGAGAAAAATATTACAAGCTCGGGGAAATTTGG
ACTGATACTGAGACATGTTCGAAATGCGTGTGCGTGATGGGCACGCCGAAATGTGAGCCG
GTCCAGTGCCCGCACGTTAACTGTTTAGTACCAACCATCCTACCGCCGGGACACTGCTGC
CCAATTTGTACAAATACTACTTCTGCTGCATGGTCAG
(217 bp)

- SilkBase 1999-2023 -