SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NameA_BomaMG_comp25776_c0_seq2
Scaffold_id
NCBI non-redundant
(nr)
atypical_protein_kinase_C_[Bombyx_mori]
Ontology
GO:0000139 C Golgi membrane
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0004697 F protein kinase C activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005543 F phospholipid binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005768 C endosome
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0005923 C bicellular tight junction
GO:0006468 P protein phosphorylation
GO:0006612 P protein targeting to membrane
GO:0007010 P cytoskeleton organization
GO:0007015 P actin filament organization
GO:0010976 P positive regulation of neuron projection development
GO:0015630 C microtubule cytoskeleton
GO:0016020 C membrane
GO:0016192 P vesicle-mediated transport
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016324 C apical plasma membrane
GO:0016477 P cell migration
GO:0016740 F transferase activity
GO:0018105 P peptidyl-serine phosphorylation
GO:0019904 F protein domain specific binding
GO:0031252 C cell leading edge
GO:0032869 P cellular response to insulin stimulus
GO:0034351 P negative regulation of glial cell apoptotic process
GO:0034613 P cellular protein localization
GO:0035089 P establishment of apical/basal cell polarity
GO:0035556 P intracellular signal transduction
GO:0042462 P eye photoreceptor cell development
GO:0043066 P negative regulation of apoptotic process
GO:0043220 C Schmidt-Lanterman incisure
GO:0043234 C protein-containing complex
GO:0043434 P response to peptide hormone
GO:0043524 P negative regulation of neuron apoptotic process
GO:0045171 C intercellular bridge
GO:0045177 C apical part of cell
GO:0045197 P establishment or maintenance of epithelial cell apical/basal polarity
GO:0045216 P cell-cell junction organization
GO:0046326 P positive regulation of glucose import
GO:0046872 F metal ion binding
GO:0046903 P secretion
GO:0048194 P Golgi vesicle budding
GO:0051092 P positive regulation of NF-kappaB transcription factor activity
GO:0060252 P positive regulation of glial cell proliferation
GO:0061024 P membrane organization
GO:0070062 C extracellular exosome
GO:0070555 P response to interleukin-1
GO:0070830 P bicellular tight junction assembly
GO:0090004 P positive regulation of protein localization to plasma membrane
GO:2000353 P positive regulation of endothelial cell apoptotic process
Transcript
Level
FPKM:2.43 TPM:2.25
ORF Entry
Sequence
(Nucleotide)
TGCTCCTCTCCTGTATATGCTCCTGTCTTCACCAGCGCAGGGCATGCCCGGCGCCGCCGG
CACGTTCGGGAACACATGTACAGTGAGTTCGGAGTCTCGGTTCAACTCGTACAGCCTCAG
TGACTCATCCAGCTCTAGCTGTGTTGATATTGTGCAGGGATCACCTTCTTCATCCACCCA
TTTCATTGTAAACACCTGATCTGGAGCAAAACGGCAAGTAGCCACCATCTCATGTGTAAA
CTCCTCAAAGGTTATGTTATGGTTGATGTATGTAATCATCACATCTCCATTGTAGACAGT
TTTCACTCGTACATCATTTACATGGTTATCCTGATTCACAAGTTGTGTCGGCATCATGAC
AGATTTATGGGCACCAAATATGTAGTAAATGAAACTTTTACGTTAATGATGATTATTTAA
AAAATAATAATAAACTGTTGCACTCAAAAGAACACAATCCCATTGATAAAAGTAATCAAA
AACTTAATTCGCTTTATCCAACACGATTTAAAGTAATAACAACAATTTACAAAAGTTTGA
CACACAGCTACACATACG
(558 bp)

- SilkBase 1999-2023 -