SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp24618_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		fibroblast_growth_factor_receptor_precursor_[Bombyx_mori]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000166 F nucleotide binding
GO:0001525 P angiogenesis
GO:0001657 P ureteric bud development
GO:0001701 P in utero embryonic development
GO:0001759 P organ induction
GO:0001948 F protein binding
GO:0002053 P positive regulation of mesenchymal cell proliferation
GO:0002062 P chondrocyte differentiation
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004714 F transmembrane receptor protein tyrosine kinase activity
GO:0005007 F fibroblast growth factor-activated receptor activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0006468 P protein phosphorylation
GO:0007037 P transmembrane phosphate ion transport from cytosol to vacuole
GO:0007420 P brain development
GO:0007435 P salivary gland morphogenesis
GO:0007605 P sensory perception of sound
GO:0008201 F heparin binding
GO:0008284 P positive regulation of cell population proliferation
GO:0008543 P fibroblast growth factor receptor signaling pathway
GO:0010468 P regulation of gene expression
GO:0010629 P negative regulation of gene expression
GO:0010863 P positive regulation of phospholipase C activity
GO:0010976 P positive regulation of neuron projection development
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016023 C cytoplasmic vesicle
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0017134 F fibroblast growth factor binding
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0019827 P stem cell population maintenance
GO:0021769 P orbitofrontal cortex development
GO:0021837 P motogenic signaling involved in postnatal olfactory bulb interneuron migration
GO:0021847 P ventricular zone neuroblast division
GO:0021954 P central nervous system neuron development
GO:0030324 P lung development
GO:0030326 P embryonic limb morphogenesis
GO:0030901 P midbrain development
GO:0031175 P neuron projection development
GO:0031410 C cytoplasmic vesicle
GO:0032403 F protein-containing complex binding
GO:0035607 P fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development
GO:0042127 P regulation of cell population proliferation
GO:0042472 P inner ear morphogenesis
GO:0042473 P outer ear morphogenesis
GO:0042474 P middle ear morphogenesis
GO:0042802 F identical protein binding
GO:0042803 F protein homodimerization activity
GO:0043235 C receptor complex
GO:0043406 P positive regulation of MAP kinase activity
GO:0043410 P positive regulation of MAPK cascade
GO:0045666 P positive regulation of neuron differentiation
GO:0045668 P negative regulation of osteoblast differentiation
GO:0045787 P positive regulation of cell cycle
GO:0046777 P protein autophosphorylation
GO:0048339 P paraxial mesoderm development
GO:0048378 P regulation of lateral mesodermal cell fate specification
GO:0048469 P cell maturation
GO:0048514 P blood vessel morphogenesis
GO:0048699 P generation of neurons
GO:0048762 P mesenchymal cell differentiation
GO:0050839 F cell adhesion molecule binding
GO:0051174 P regulation of phosphorus metabolic process
GO:0051930 P regulation of sensory perception of pain
GO:0060045 P positive regulation of cardiac muscle cell proliferation
GO:0060117 P auditory receptor cell development
GO:0060445 P branching involved in salivary gland morphogenesis
GO:0060484 P lung-associated mesenchyme development
GO:0060665 P regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling
GO:0060979 P vasculogenesis involved in coronary vascular morphogenesis
GO:0070640 P vitamin D3 metabolic process
GO:0072091 P regulation of stem cell proliferation
GO:0090080 P positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway
GO:0090272 P negative regulation of fibroblast growth factor production
GO:2000546 P positive regulation of endothelial cell chemotaxis to fibroblast growth factor
GO:2000830 P positive regulation of parathyroid hormone secretion
GO:2001239 P regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level		FPKM:1.00 TPM:0.93
ORF Entry
Sequence
(Nucleotide)
CTTCACCGTAACAAAATTCTAGACCTCAATAAGATCGCCCCCAGGAATCGGCATATCACT
CGGCCCAACTTCTACGTCTTTCATAGAGTAATTCGTCGGTCGGATCCAGTAAAGATATGG
CTCCAGGTCAGAGACTGGTGGGCAGGAGAGCTTCACAGTCTCGTTGAGCAAGACGGTTTT
ATTACCAGGATAGCCTTCTTTAATATACGGCTTCGATGGATAACGCTCTTGTATGTGTAA
CACAACAGTGTGCTCAATGCAACCCAGTTCATTGCAAACAACGCAAGTGTAATTTCCGTT
ATCTGCTTTGGTAAGTTCGTCTAAATTTATCGCCCATTTAGCGTAGCTAGGCTGGAAGTA
TGTCCTTTGTATTGGATTACTTTTGTTTTTGTACCACGTAATATTTGGCGTGGGATTCCC
TTCAGCAGGACATTTAAATCTGACAGAGCTGCCAGCAGGCTTCATTTCCATAGTGTACAT
TTTTGATGGATGTTTAAATTTGGGAGGGTATTTCTTTTTAGTTTCATCCACGTGTCCGTA
AACGGGATGATCCTTTTCACTTTTATCATCAGGATCCTCATCTTTTGAATCGATCTCTTT
TAATTTCATTGTTCTTGCTAATCGTTTTATTTCAGTCGTATTGTCTTCAAATTTGTTATT
TTCGTGTAGCGAAACAGCTTGGTGTTGCGATAGTATTTCTGGCATTGGCCTGTCTACATC
CACATCTGCTTGATATTCTTCTAAATTATCTTGATCTTGTCCAATCTTGTGCTTGATCGT
GACAGCCATTTCCTTGAACTTATCTTCTTCGTTTTGGCACGAGTAAACACCAGCGTCTTT
CGCTCTAAATCCTTTTATTCTTAACCATTGCCTTTGTTGTGTTATCCTCTTGGACACTCC
ATCCAGAGCCTGGCCATCTTTAAACCACTCCACCATCTGTGCTTGACTCCGAGGCTTAAG
GCCGCAGATCAGACGAAGTCTATCATTTGTGGCCGCTTCAATTACTGTGTAATTGTCATC
TAGTACAATATCTCTTGCTGAAACTGTACACGTGGCTACCAAGGTAATCAGTAGTACGGT
TACGCGCGTAACGCGCCAAAACGCAATGGCGGTGAGGTTCATTTCTGTTTTCGAACCTCA
ACTCCTTGTCGAATCCATTAGATACTTAGTGGAATGAAAACAATCCTGCCGTGGATTATA
TTCCAATATTAAATAAAACAGTTTTAAAACAGTTCACCAAAACGGTCACCGGAATACACA
GAACACAGTCACCG
(1274 bp)

- SilkBase 1999-2023 -