SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp16594_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		putative_zinc_finger_protein_84_[Danaus_plexippus]
Ontology
GO:0000122 P negative regulation of transcription by RNA polymerase II
GO:0000792 C heterochromatin
GO:0001085 F RNA polymerase II-specific DNA-binding transcription factor binding
GO:0001105 F transcription coactivator activity
GO:0001158 F cis-regulatory region sequence-specific DNA binding
GO:0001657 P ureteric bud development
GO:0001658 P branching involved in ureteric bud morphogenesis
GO:0001822 P kidney development
GO:0001843 P neural tube closure
GO:0003281 P ventricular septum development
GO:0003337 P mesenchymal to epithelial transition involved in metanephros morphogenesis
GO:0003340 P negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0003682 F chromatin binding
GO:0004407 F histone deacetylase activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0007507 P heart development
GO:0008013 F beta-catenin binding
GO:0010369 C chromocenter
GO:0016575 P histone deacetylation
GO:0016581 C NuRD complex
GO:0021553 P olfactory nerve development
GO:0021772 P olfactory bulb development
GO:0021889 P olfactory bulb interneuron differentiation
GO:0021915 P neural tube development
GO:0030177 P positive regulation of Wnt signaling pathway
GO:0031129 P inductive cell-cell signaling
GO:0035136 P forelimb morphogenesis
GO:0035137 P hindlimb morphogenesis
GO:0042473 P outer ear morphogenesis
GO:0042733 P embryonic digit morphogenesis
GO:0045666 P positive regulation of neuron differentiation
GO:0045879 P negative regulation of smoothened signaling pathway
GO:0045892 P negative regulation of transcription, DNA-templated
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046872 F metal ion binding
GO:0048566 P embryonic digestive tract development
GO:0060173 P limb development
GO:0061034 P olfactory bulb mitral cell layer development
GO:0072073 P kidney epithelium development
GO:0072092 P ureteric bud invasion
GO:0072309 P mesenchymal stem cell maintenance involved in metanephric nephron morphogenesis
GO:0090190 P positive regulation of branching involved in ureteric bud morphogenesis
GO:2000177 P regulation of neural precursor cell proliferation
GO:2000381 P negative regulation of mesoderm development
GO:2000384 P negative regulation of ectoderm development
Transcript
Level		FPKM:1.82 TPM:1.68
ORF Entry
Sequence
(Nucleotide)
TGGACATCTTCCAGATGCTTCTGCCTATAAACGTACTCCGTGAACCGCTCCGAGCATTTA
TTGCAGCGGAACCTCTTCACCATTTTGTGTACCGAATTGATATGATTCTTCAGTCGGAGT
TGCGTTACGAACATCTTTCCGCACATCTCGCAGGGGAACGCCCCGCCGACGTGCGTGTTC
CCGAAGTGCACTTTTAGTCTGGCCCTCG
(208 bp)

- SilkBase 1999-2023 -