SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp1649_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_NCK-interacting_protein_with_SH3_domain_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0001784 F phosphotyrosine residue binding
GO:0002376 P immune system process
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004715 F non-membrane spanning protein tyrosine kinase activity
GO:0005102 F signaling receptor binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
GO:0005758 C mitochondrial intermembrane space
GO:0005829 C cytosol
GO:0005856 C cytoskeleton
GO:0005886 C plasma membrane
GO:0006468 P protein phosphorylation
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007229 P integrin-mediated signaling pathway
GO:0008150 P biological_process
GO:0008360 P regulation of cell shape
GO:0014068 P positive regulation of phosphatidylinositol 3-kinase signaling
GO:0015629 C actin cytoskeleton
GO:0016020 C membrane
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016477 P cell migration
GO:0016740 F transferase activity
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0019901 F protein kinase binding
GO:0030154 P cell differentiation
GO:0030335 P positive regulation of cell migration
GO:0031234 C extrinsic component of cytoplasmic side of plasma membrane
GO:0032587 C ruffle membrane
GO:0034987 F immunoglobulin receptor binding
GO:0034988 F Fc-gamma receptor I complex binding
GO:0038083 P peptidyl-tyrosine autophosphorylation
GO:0042127 P regulation of cell population proliferation
GO:0042995 C cell projection
GO:0043306 P positive regulation of mast cell degranulation
GO:0043552 P positive regulation of phosphatidylinositol 3-kinase activity
GO:0045087 P innate immune response
GO:0045088 P regulation of innate immune response
GO:0045859 P regulation of protein kinase activity
GO:0046777 P protein autophosphorylation
GO:0050715 P positive regulation of cytokine production
GO:0050764 P regulation of phagocytosis
GO:0050830 P defense response to Gram-positive bacterium
GO:0070062 C extracellular exosome
Transcript
Level		FPKM:1.87 TPM:1.73
ORF Entry
Sequence
(Nucleotide)
GATCGCTCAAAAAAGCCAACAGGTACTCCGCCTCTACCTTGACTGTAGCTACATAATTAG
AGGGCACAAAGCCGACCTGACCTTTCCTATTAACAACATGCCACCAGTTTCGTTGTTTAG
TGTTGCTCTGTTGCAAATAAAAATATTCACCTTCCGAAAAACTTAACGTTTTTGCCAATG
TGGCTTCAAAATCAAATAAGGCTTTGAGCTTTTCGAAATCATCGTTTTG
(229 bp)

- SilkBase 1999-2023 -