SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp16378_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_protein_kinase_C_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0002281 P macrophage activation involved in immune response
GO:0002376 P immune system process
GO:0003785 F actin monomer binding
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0004697 F protein kinase C activity
GO:0004699 F calcium-independent protein kinase C activity
GO:0004871 F obsolete signal transducer activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005739 C mitochondrion
GO:0005783 C endoplasmic reticulum
GO:0005794 C Golgi apparatus
GO:0005829 C cytosol
GO:0005856 C cytoskeleton
GO:0005886 C plasma membrane
GO:0006468 P protein phosphorylation
GO:0006915 P apoptotic process
GO:0007049 P cell cycle
GO:0007155 P cell adhesion
GO:0007165 P signal transduction
GO:0007202 P activation of phospholipase C activity
GO:0008047 F enzyme activator activity
GO:0010634 P positive regulation of epithelial cell migration
GO:0010763 P positive regulation of fibroblast migration
GO:0010811 P positive regulation of cell-substrate adhesion
GO:0016020 C membrane
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0018105 P peptidyl-serine phosphorylation
GO:0019216 P regulation of lipid metabolic process
GO:0019899 F enzyme binding
GO:0030168 P platelet activation
GO:0030546 F signaling receptor activator activity
GO:0030838 P positive regulation of actin filament polymerization
GO:0031397 P negative regulation of protein ubiquitination
GO:0031663 P lipopolysaccharide-mediated signaling pathway
GO:0032024 P positive regulation of insulin secretion
GO:0032230 P positive regulation of synaptic transmission, GABAergic
GO:0032467 P positive regulation of cytokinesis
GO:0035276 F ethanol binding
GO:0035556 P intracellular signal transduction
GO:0035641 P locomotory exploration behavior
GO:0035669 P TRAM-dependent toll-like receptor 4 signaling pathway
GO:0038096 P Fc-gamma receptor signaling pathway involved in phagocytosis
GO:0043123 P positive regulation of I-kappaB kinase/NF-kappaB signaling
GO:0043278 P response to morphine
GO:0043410 P positive regulation of MAPK cascade
GO:0046872 F metal ion binding
GO:0048471 C perinuclear region of cytoplasm
GO:0050730 P regulation of peptidyl-tyrosine phosphorylation
GO:0050996 P positive regulation of lipid catabolic process
GO:0051209 P release of sequestered calcium ion into cytosol
GO:0051279 P regulation of release of sequestered calcium ion into cytosol
GO:0051301 P cell division
GO:0061178 P regulation of insulin secretion involved in cellular response to glucose stimulus
GO:0070257 P positive regulation of mucus secretion
GO:0071361 P cellular response to ethanol
GO:0071380 P cellular response to prostaglandin E stimulus
GO:0071456 P cellular response to hypoxia
GO:0071889 F 14-3-3 protein binding
GO:0071944 C cell periphery
GO:0090303 P positive regulation of wound healing
GO:2000273 P positive regulation of signaling receptor activity
GO:2000650 P negative regulation of sodium ion transmembrane transporter activity
GO:2001031 P positive regulation of cellular glucuronidation
Transcript
Level		FPKM:1.88 TPM:1.74
ORF Entry
Sequence
(Nucleotide)
GACGGCGTCGCGCGAGAGCCACACGGGGTAGAGCACGTCGTCGTGCAGGATGGACTCGAA
CAGGTCGTCCTCGTTGTCGGCCTCGAAGGGCGGCTGTCCGGCCAGCATCTCGTACAGCAG
CACGCCCAGCGCCCACCAGTCCACGCTGCAGCCGTACTCCTGCTCCTGCAGGATCTCTGG
CGCGATGTAGTCCGGGGTCCCGCAGAACGTGGTGGTGGTCACGCCGTCGATGATGCCCTC
CTTGCACATGCCGAAGTCGGCGAGCTTGCAGTGTCCCTCGGAGTCGAGCAGGATGTTGTC
GAGCTTGAGGTCGCGGTAGATGACG
(325 bp)

- SilkBase 1999-2023 -