SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp15390_c1_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_developmental_protein_eyes_absent_[Bombyx_mori]
Ontology
GO:0000132 P establishment of mitotic spindle orientation
GO:0001656 P metanephros development
GO:0001657 P ureteric bud development
GO:0001658 P branching involved in ureteric bud morphogenesis
GO:0003151 P outflow tract morphogenesis
GO:0003723 F RNA binding
GO:0004721 F phosphoprotein phosphatase activity
GO:0004725 F protein tyrosine phosphatase activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0006281 P DNA repair
GO:0006302 P double-strand break repair
GO:0006351 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0006470 P protein dephosphorylation
GO:0006974 P cellular response to DNA damage stimulus
GO:0007275 P multicellular organism development
GO:0007389 P pattern specification process
GO:0007501 P mesodermal cell fate specification
GO:0009887 P animal organ morphogenesis
GO:0010212 P response to ionizing radiation
GO:0014706 P striated muscle tissue development
GO:0016568 P chromatin organization
GO:0016576 P histone dephosphorylation
GO:0016787 F hydrolase activity
GO:0016925 P protein sumoylation
GO:0032993 C protein-DNA complex
GO:0034613 P cellular protein localization
GO:0035088 P establishment or maintenance of apical/basal cell polarity
GO:0035335 P peptidyl-tyrosine dephosphorylation
GO:0035909 P aorta morphogenesis
GO:0042471 P ear morphogenesis
GO:0042472 P inner ear morphogenesis
GO:0042473 P outer ear morphogenesis
GO:0042474 P middle ear morphogenesis
GO:0043234 C protein-containing complex
GO:0045165 P cell fate commitment
GO:0045664 P regulation of neuron differentiation
GO:0045739 P positive regulation of DNA repair
GO:0045747 P positive regulation of Notch signaling pathway
GO:0045893 P positive regulation of transcription, DNA-templated
GO:0045944 P positive regulation of transcription by RNA polymerase II
GO:0046872 F metal ion binding
GO:0048665 P neuron fate specification
GO:0048704 P embryonic skeletal system morphogenesis
GO:0048752 P semicircular canal morphogenesis
GO:0048856 P anatomical structure development
GO:0050679 P positive regulation of epithelial cell proliferation
GO:0060037 P pharyngeal system development
GO:0060487 P lung epithelial cell differentiation
GO:0071599 P otic vesicle development
GO:0071600 P otic vesicle morphogenesis
GO:0072513 P positive regulation of secondary heart field cardioblast proliferation
GO:0090103 P cochlea morphogenesis
GO:2001240 P negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level		FPKM:1.75 TPM:1.62
ORF Entry
Sequence
(Nucleotide)
GCGGAGTATATATTTTCGATAGGAAACACGCCCCCTAAGCCGAAGAGCAGGACTTTCGCC
AAAGCCGGGACGAGCTGAGTCGTCGTGACTAAAACATTCACGCAGTTCTCTCGAGAATTA
ATCATGTTTAGACACTTGCAGGCTAATGTTAACCAGTTATCCGTGGCCTGTTCTAGTTCT
GCTCTCAGTTGTAACCACTGTTCTCTCTTTGCTGGCCCTAGGAGCCCTCCAACACTATTC
CTGTAATTATTGTAGGTGTCTTTGATCTTCCTGTACCGGAAGGCTAGTTTCCTCATCCAG
TCGACTCCGCCTCGGACCCCAGGCGCACACAAAGCGCCTCCCGCCGCGCCCGCATGAAAC
CCATCCGTTGTGAAGTTGTACGCAGAGAGATCCTG
(395 bp)

- SilkBase 1999-2023 -