SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp14415_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_insulin_receptor_isoform_X2_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004714 F transmembrane receptor protein tyrosine kinase activity
GO:0005010 F insulin-like growth factor-activated receptor activity
GO:0005158 F insulin receptor binding
GO:0005515 F protein binding
GO:0005520 F insulin-like growth factor binding
GO:0005524 F ATP binding
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006468 P protein phosphorylation
GO:0006955 P immune response
GO:0007165 P signal transduction
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0008284 P positive regulation of cell population proliferation
GO:0008286 P insulin receptor signaling pathway
GO:0014065 P phosphatidylinositol 3-kinase signaling
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0030335 P positive regulation of cell migration
GO:0031994 F insulin-like growth factor I binding
GO:0038083 P peptidyl-tyrosine autophosphorylation
GO:0042802 F identical protein binding
GO:0043066 P negative regulation of apoptotic process
GO:0043231 C intracellular membrane-bounded organelle
GO:0043235 C receptor complex
GO:0043548 F phosphatidylinositol 3-kinase binding
GO:0043559 F insulin binding
GO:0043560 F insulin receptor substrate binding
GO:0045740 P positive regulation of DNA replication
GO:0046328 P regulation of JNK cascade
GO:0046777 P protein autophosphorylation
GO:0048009 P insulin-like growth factor receptor signaling pathway
GO:0048015 P phosphatidylinositol-mediated signaling
GO:0051262 P protein tetramerization
GO:0051389 P obsolete inactivation of MAPKK activity
Transcript
Level		FPKM:2.38 TPM:2.21
ORF Entry
Sequence
(Nucleotide)
AGACAGCAACGGGTATCAGGCATCTTGTCTCCCGGACGTCCTGAAGCTGAGCGTGTCGGA
GTTAACGCAAATCGCAGTGGTACTAACTTGGGATGTGTACTGTCCCGACGACATGCGCAA
GCTGCTCGGATACTCGCTGTACTTTATGGCCACCGAGAAGAACGTAACTCTGTACGATCA
ACGCGATGCCTGCTCTGATATATGGAAAGTACTCGACAAGCCAATAGAGGAG
(232 bp)

- SilkBase 1999-2023 -