SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp11260_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_phosphatidylinositol_3,4,5-trisphosphate_3-phosphatase_and_dual-specificity_protein_phosphatase_PTEN_isoform_X2_[Bombyx_mori]
Ontology
GO:0000079 P regulation of cyclin-dependent protein serine/threonine kinase activity
GO:0000287 F magnesium ion binding
GO:0001525 P angiogenesis
GO:0001933 P negative regulation of protein phosphorylation
GO:0002902 P regulation of B cell apoptotic process
GO:0004438 F phosphatidylinositol-3-phosphatase activity
GO:0004721 F phosphoprotein phosphatase activity
GO:0004722 F protein serine/threonine phosphatase activity
GO:0004725 F protein tyrosine phosphatase activity
GO:0005161 F platelet-derived growth factor receptor binding
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005737 C cytoplasm
GO:0005739 C mitochondrion
GO:0005829 C cytosol
GO:0005886 C plasma membrane
GO:0006470 P protein dephosphorylation
GO:0006629 P lipid metabolic process
GO:0006661 P phosphatidylinositol biosynthetic process
GO:0006915 P apoptotic process
GO:0007092 P positive regulation of ubiquitin protein ligase activity
GO:0007270 P neuron-neuron synaptic transmission
GO:0007399 P nervous system development
GO:0007416 P synapse assembly
GO:0007417 P central nervous system development
GO:0007507 P heart development
GO:0007568 P aging
GO:0007584 P response to nutrient
GO:0007611 P learning or memory
GO:0007613 P memory
GO:0007626 P locomotory behavior
GO:0008138 F protein tyrosine/serine/threonine phosphatase activity
GO:0008283 P cell population proliferation
GO:0008284 P positive regulation of cell population proliferation
GO:0008285 P negative regulation of cell population proliferation
GO:0008289 F lipid binding
GO:0009749 P response to glucose
GO:0009898 C cytoplasmic side of plasma membrane
GO:0010033 P response to organic substance
GO:0010035 P response to inorganic substance
GO:0010043 P response to zinc ion
GO:0010975 P regulation of neuron projection development
GO:0010997 F anaphase-promoting complex binding
GO:0014067 P negative regulation of phosphatidylinositol 3-kinase signaling
GO:0014070 P response to organic cyclic compound
GO:0016311 P dephosphorylation
GO:0016314 F phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity
GO:0016324 C apical plasma membrane
GO:0016477 P cell migration
GO:0016605 C PML body
GO:0016787 F hydrolase activity
GO:0016791 F phosphatase activity
GO:0019899 F enzyme binding
GO:0019901 F protein kinase binding
GO:0021542 P dentate gyrus development
GO:0021955 P central nervous system neuron axonogenesis
GO:0030165 F PDZ domain binding
GO:0030336 P negative regulation of cell migration
GO:0030534 P adult behavior
GO:0031175 P neuron projection development
GO:0031642 P negative regulation of myelination
GO:0031647 P regulation of protein stability
GO:0031658 P obsolete negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle
GO:0032228 P regulation of synaptic transmission, GABAergic
GO:0032286 P central nervous system myelin maintenance
GO:0032355 P response to estradiol
GO:0032535 P regulation of cellular component size
GO:0033032 P regulation of myeloid cell apoptotic process
GO:0033198 P response to ATP
GO:0033555 P multicellular organismal response to stress
GO:0035176 P social behavior
GO:0035335 P peptidyl-tyrosine dephosphorylation
GO:0035749 C myelin sheath adaxonal region
GO:0036294 P cellular response to decreased oxygen levels
GO:0042493 P response to xenobiotic stimulus
GO:0042711 P maternal behavior
GO:0042802 F identical protein binding
GO:0042995 C cell projection
GO:0043005 C neuron projection
GO:0043065 P positive regulation of apoptotic process
GO:0043066 P negative regulation of apoptotic process
GO:0043197 C dendritic spine
GO:0043220 C Schmidt-Lanterman incisure
GO:0043491 P protein kinase B signaling
GO:0043542 P endothelial cell migration
GO:0043647 P inositol phosphate metabolic process
GO:0045211 C postsynaptic membrane
GO:0045471 P response to ethanol
GO:0045475 P locomotor rhythm
GO:0045792 P negative regulation of cell size
GO:0046621 P negative regulation of organ growth
GO:0046685 P response to arsenic-containing substance
GO:0046855 P inositol phosphate dephosphorylation
GO:0046856 P phosphatidylinositol dephosphorylation
GO:0048008 P platelet-derived growth factor receptor signaling pathway
GO:0048015 P phosphatidylinositol-mediated signaling
GO:0048679 P regulation of axon regeneration
GO:0048738 P cardiac muscle tissue development
GO:0048853 P forebrain morphogenesis
GO:0048854 P brain morphogenesis
GO:0050680 P negative regulation of epithelial cell proliferation
GO:0050765 P negative regulation of phagocytosis
GO:0050771 P negative regulation of axonogenesis
GO:0050821 P protein stabilization
GO:0050852 P T cell receptor signaling pathway
GO:0051091 P positive regulation of DNA-binding transcription factor activity
GO:0051717 F inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity
GO:0051726 P regulation of cell cycle
GO:0051800 F phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity
GO:0051895 P negative regulation of focal adhesion assembly
GO:0051898 P negative regulation of protein kinase B signaling
GO:0060024 P rhythmic synaptic transmission
GO:0060070 P canonical Wnt signaling pathway
GO:0060074 P synapse maturation
GO:0060134 P prepulse inhibition
GO:0060179 P male mating behavior
GO:0060291 P long-term synaptic potentiation
GO:0060292 P long-term synaptic depression
GO:0060341 P regulation of cellular localization
GO:0060736 P prostate gland growth
GO:0060997 P dendritic spine morphogenesis
GO:0061002 P negative regulation of dendritic spine morphogenesis
GO:0070373 P negative regulation of ERK1 and ERK2 cascade
GO:0070374 P positive regulation of ERK1 and ERK2 cascade
GO:0071456 P cellular response to hypoxia
GO:0090071 P negative regulation of ribosome biogenesis
GO:0090344 P negative regulation of cell aging
GO:0090394 P negative regulation of excitatory postsynaptic potential
GO:0097105 P presynaptic membrane assembly
GO:0097107 P postsynaptic density assembly
GO:1903984 P positive regulation of TRAIL-activated apoptotic signaling pathway
GO:2000060 P positive regulation of ubiquitin-dependent protein catabolic process
GO:2000134 P negative regulation of G1/S transition of mitotic cell cycle
GO:2000463 P positive regulation of excitatory postsynaptic potential
GO:2000808 P negative regulation of synaptic vesicle clustering
GO:2001235 P positive regulation of apoptotic signaling pathway
Transcript
Level		FPKM:4.24 TPM:3.92
ORF Entry
Sequence
(Nucleotide)
GCGTGAGCTGCCGGCGCCGAGAGCGGAAGATCCCAGAAAAGCGGTCGGTGCCGGGAGTGG
TTGGGCCCGCTAAGGGCGCGGCGGCGGAGCTGCTGCCCAGGCCAGTGAATCGCTTTACAG
CCATGGCAAACTCCATGTCAAATATCAAGATGACCAACCCGATAAAGAATATGGTCAGCA
AGCGCAGGATACGCTACACCAAGCACGGATTCAACCTGGACTTAGCCTATATCACAGACA
GGCTGATAGCGATGGGTTTCCCGGCCGAGAAATTGGAAGGAGTATACAGGAATCACATAG
ACGAAGTGTATAGGTTTTTAGAGACAATGCACAAGGATCACTACAAGATATACAACTTGT
GCTCGGAGAGGACATACGACCCGAGCAAGTTTCATAAGAGGGTGGAGAGATATGCGTTCG
AAGACCACACCCCGCCCCACATGGAGCTGATACAGCCATTCTGCGAGAACGTGCACAGTT
GGCTCAGTGCGGATACAAGGAACGTTGCCGTCGTACATTGTAAAGCTGGGAAAGGTCGGA
CCGGTACGATGGTCTGTTGTTATTTGTTATACAGCGGGGACCAGCCTAATGCAGACGAAG
CGCTAAAGTTCTACGGCAGGAAGAGAACTCTAGATGAAAAGGGCGTGACGATACCGTCGC
AGCGGCGCTACGTGGAGTACTACGGGGCGCTGCTGCGGTCGGGCGTGGCGTACCGGGCGG
GCGCG
(725 bp)

- SilkBase 1999-2023 -