SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp10718_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_DNA_mismatch_repair_protein_Mlh1_[Papilio_machaon]
Ontology
GO:0000289 P nuclear-transcribed mRNA poly(A) tail shortening
GO:0000712 P resolution of meiotic recombination intermediates
GO:0000793 C condensed chromosome
GO:0000794 C condensed nuclear chromosome
GO:0000795 C synaptonemal complex
GO:0001673 C male germ cell nucleus
GO:0002204 P somatic recombination of immunoglobulin genes involved in immune response
GO:0003682 F chromatin binding
GO:0003697 F single-stranded DNA binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005654 C nucleoplasm
GO:0005694 C chromosome
GO:0005712 C chiasma
GO:0006281 P DNA repair
GO:0006298 P mismatch repair
GO:0006303 P double-strand break repair via nonhomologous end joining
GO:0006974 P cellular response to DNA damage stimulus
GO:0007049 P cell cycle
GO:0007060 P male meiosis chromosome segregation
GO:0007126 P meiotic cell cycle
GO:0007129 P homologous chromosome pairing at meiosis
GO:0007131 P reciprocal meiotic recombination
GO:0007140 P male meiotic nuclear division
GO:0007283 P spermatogenesis
GO:0008630 P intrinsic apoptotic signaling pathway in response to DNA damage
GO:0016020 C membrane
GO:0016321 P female meiosis chromosome segregation
GO:0016446 P somatic hypermutation of immunoglobulin genes
GO:0016447 P somatic recombination of immunoglobulin gene segments
GO:0016887 F ATP hydrolysis activity
GO:0030983 F mismatched DNA binding
GO:0032137 F guanine/thymine mispair binding
GO:0032389 C MutLalpha complex
GO:0032407 F MutSalpha complex binding
GO:0043060 P meiotic metaphase I plate congression
GO:0045132 P meiotic chromosome segregation
GO:0045141 P meiotic telomere clustering
GO:0045143 P homologous chromosome segregation
GO:0045190 P isotype switching
GO:0045950 P negative regulation of mitotic recombination
GO:0048477 P oogenesis
GO:0051257 P meiotic spindle midzone assembly
Transcript
Level		FPKM:2.84 TPM:2.63
ORF Entry
Sequence
(Nucleotide)
TCGCTCCATTACTTACAAAACTACTTGGCGGTAGGAAATATTTTCTTATGGCCGGGAATA
TCACGTGCTCTTGTCTCCTGTGCTCCGACGACACGTTCTCGGCATTCGGATCCGGATTAG
GTTGGGCATAAAACTTGGCCGTCTGTCTGCAGAAAGTCTCAAAGCACTCCTTTTCAGAAT
CCCAATTGACTTCGGTAACGAGGCGGACTAAATACGTCGGA
(221 bp)

- SilkBase 1999-2023 -