SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp10661_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_neurofibromin_[Bombyx_mori]
Ontology
GO:0000165 P MAPK cascade
GO:0001649 P osteoblast differentiation
GO:0001656 P metanephros development
GO:0001666 P response to hypoxia
GO:0001889 P liver development
GO:0001952 P regulation of cell-matrix adhesion
GO:0005096 F GTPase activator activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005730 C nucleolus
GO:0005737 C cytoplasm
GO:0006469 P negative regulation of protein kinase activity
GO:0007154 P cell communication
GO:0007165 P signal transduction
GO:0007265 P Ras protein signal transduction
GO:0007406 P negative regulation of neuroblast proliferation
GO:0007420 P brain development
GO:0007422 P peripheral nervous system development
GO:0007507 P heart development
GO:0008017 F microtubule binding
GO:0008289 F lipid binding
GO:0008429 F phosphatidylethanolamine binding
GO:0008542 P visual learning
GO:0014044 P Schwann cell development
GO:0014065 P phosphatidylinositol 3-kinase signaling
GO:0014069 C postsynaptic density
GO:0016020 C membrane
GO:0021510 P spinal cord development
GO:0021897 P forebrain astrocyte development
GO:0021987 P cerebral cortex development
GO:0022011 P myelination in peripheral nervous system
GO:0030036 P actin cytoskeleton organization
GO:0030198 P extracellular matrix organization
GO:0030199 P collagen fibril organization
GO:0030325 P adrenal gland development
GO:0030424 C axon
GO:0030425 C dendrite
GO:0031210 F phosphatidylcholine binding
GO:0031235 C intrinsic component of the cytoplasmic side of the plasma membrane
GO:0042060 P wound healing
GO:0042992 P obsolete negative regulation of transcription factor import into nucleus
GO:0043005 C neuron projection
GO:0043065 P positive regulation of apoptotic process
GO:0043087 P regulation of GTPase activity
GO:0043234 C protein-containing complex
GO:0043407 P negative regulation of MAP kinase activity
GO:0043409 P negative regulation of MAPK cascade
GO:0043473 P pigmentation
GO:0043525 P positive regulation of neuron apoptotic process
GO:0043547 P positive regulation of GTPase activity
GO:0045124 P regulation of bone resorption
GO:0045545 F syndecan binding
GO:0045664 P regulation of neuron differentiation
GO:0045685 P regulation of glial cell differentiation
GO:0045762 P positive regulation of adenylate cyclase activity
GO:0045765 P regulation of angiogenesis
GO:0046580 P negative regulation of Ras protein signal transduction
GO:0048147 P negative regulation of fibroblast proliferation
GO:0048485 P sympathetic nervous system development
GO:0048593 P camera-type eye morphogenesis
GO:0048715 P negative regulation of oligodendrocyte differentiation
GO:0048745 P smooth muscle tissue development
GO:0048844 P artery morphogenesis
GO:0048853 P forebrain morphogenesis
Transcript
Level		FPKM:1.01 TPM:0.94
ORF Entry
Sequence
(Nucleotide)
GGCGTCGTTGTTGTGGGGCATGATGCGGAACAGGGACACGAAGCAGTCGGTCATGAGGTC
CAGGTCCGAGTAGCCGGACAGCACGCTGCCGCGTATGTACGACTTCGAGGGGTTGAACAG
CAGCGACTTGAGGTCGTTGATGACAGACTTCACCAGTACGAAGGTCACGTTCCCGGAGTC
GGCCGTCTTCAGGTACGTTGAAG
(203 bp)

- SilkBase 1999-2023 -