SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaMG_comp102_c0_seq1
Scaffold_id
NCBI non-redundant
(nr)		PREDICTED:_neurofibromin_isoform_X2_[Papilio_xuthus]
Ontology
GO:0000165 P MAPK cascade
GO:0001649 P osteoblast differentiation
GO:0001656 P metanephros development
GO:0001666 P response to hypoxia
GO:0001889 P liver development
GO:0001937 P negative regulation of endothelial cell proliferation
GO:0001938 P positive regulation of endothelial cell proliferation
GO:0001952 P regulation of cell-matrix adhesion
GO:0001953 P negative regulation of cell-matrix adhesion
GO:0005096 F GTPase activator activity
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005730 C nucleolus
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0006469 P negative regulation of protein kinase activity
GO:0007154 P cell communication
GO:0007165 P signal transduction
GO:0007265 P Ras protein signal transduction
GO:0007406 P negative regulation of neuroblast proliferation
GO:0007420 P brain development
GO:0007422 P peripheral nervous system development
GO:0007507 P heart development
GO:0007519 P skeletal muscle tissue development
GO:0008285 P negative regulation of cell population proliferation
GO:0008289 F lipid binding
GO:0008429 F phosphatidylethanolamine binding
GO:0008542 P visual learning
GO:0008625 P extrinsic apoptotic signaling pathway via death domain receptors
GO:0010468 P regulation of gene expression
GO:0014044 P Schwann cell development
GO:0014065 P phosphatidylinositol 3-kinase signaling
GO:0016020 C membrane
GO:0016525 P negative regulation of angiogenesis
GO:0021510 P spinal cord development
GO:0021764 P amygdala development
GO:0021897 P forebrain astrocyte development
GO:0021915 P neural tube development
GO:0021987 P cerebral cortex development
GO:0022011 P myelination in peripheral nervous system
GO:0030036 P actin cytoskeleton organization
GO:0030198 P extracellular matrix organization
GO:0030199 P collagen fibril organization
GO:0030325 P adrenal gland development
GO:0030336 P negative regulation of cell migration
GO:0030424 C axon
GO:0030425 C dendrite
GO:0031210 F phosphatidylcholine binding
GO:0031235 C intrinsic component of the cytoplasmic side of the plasma membrane
GO:0032228 P regulation of synaptic transmission, GABAergic
GO:0034605 P cellular response to heat
GO:0035021 P negative regulation of Rac protein signal transduction
GO:0042060 P wound healing
GO:0042127 P regulation of cell population proliferation
GO:0042992 P obsolete negative regulation of transcription factor import into nucleus
GO:0043065 P positive regulation of apoptotic process
GO:0043087 P regulation of GTPase activity
GO:0043407 P negative regulation of MAP kinase activity
GO:0043408 P regulation of MAPK cascade
GO:0043409 P negative regulation of MAPK cascade
GO:0043473 P pigmentation
GO:0043525 P positive regulation of neuron apoptotic process
GO:0043535 P regulation of blood vessel endothelial cell migration
GO:0043547 P positive regulation of GTPase activity
GO:0045124 P regulation of bone resorption
GO:0045671 P negative regulation of osteoclast differentiation
GO:0045685 P regulation of glial cell differentiation
GO:0045762 P positive regulation of adenylate cyclase activity
GO:0045765 P regulation of angiogenesis
GO:0046580 P negative regulation of Ras protein signal transduction
GO:0046929 P negative regulation of neurotransmitter secretion
GO:0048147 P negative regulation of fibroblast proliferation
GO:0048169 P regulation of long-term neuronal synaptic plasticity
GO:0048485 P sympathetic nervous system development
GO:0048593 P camera-type eye morphogenesis
GO:0048712 P negative regulation of astrocyte differentiation
GO:0048715 P negative regulation of oligodendrocyte differentiation
GO:0048745 P smooth muscle tissue development
GO:0048844 P artery morphogenesis
GO:0048853 P forebrain morphogenesis
GO:0050890 P cognition
GO:0061534 P gamma-aminobutyric acid secretion, neurotransmission
GO:0061535 P glutamate secretion, neurotransmission
GO:0098597 P observational learning
GO:0098793 C presynapse
GO:1900271 P regulation of long-term synaptic potentiation
GO:1902043 P positive regulation of extrinsic apoptotic signaling pathway via death domain receptors
GO:2001241 P positive regulation of extrinsic apoptotic signaling pathway in absence of ligand
Transcript
Level		FPKM:1.71 TPM:1.58
ORF Entry
Sequence
(Nucleotide)
GGTTCCCCTATGATCGAGATAATGGCGGACACCGCTGTGGCGCTGGCGTCGGCCAACGTT
CAACTCGTATCGAAAAAAGTCATCGGTAGAATGTGCCGCGCCCTTACCAAACTGCCAAAT
AACGTTCTGGGTCCGGTGACACCGGCTACCGTGGTCGACAAAACCTGCCACTCCCCGACA
GCGATGCTCGAGCAACACATGATGTGGGATGACATCGCCATATTGGCTAGATACCTGCTG
ATGTTATCGTTCAACAACTGTCTGGACGTGGCCCGCCACCTGCCCTACCTGTTCCACACG
GTCACGTTCCTCGTGTGCTCAGGGACCGTCTCGATGAGGG
(340 bp)

- SilkBase 1999-2023 -