| Name | A_BomaMG_comp10100_c0_seq1 |
| Scaffold_id | |
NCBI non-redundant (nr) | PREDICTED:_double_C2-like_domain-containing_protein_beta,_partial_[Papilio_machaon] |
| Ontology |
| GO:0005509 |
F |
calcium ion binding |
| GO:0005515 |
F |
protein binding |
| GO:0005544 |
F |
calcium-dependent phospholipid binding |
| GO:0005737 |
C |
cytoplasm |
| GO:0005886 |
C |
plasma membrane |
| GO:0006906 |
P |
vesicle fusion |
| GO:0008104 |
P |
protein localization |
| GO:0016020 |
C |
membrane |
| GO:0017158 |
P |
regulation of calcium ion-dependent exocytosis |
| GO:0019905 |
F |
syntaxin binding |
| GO:0030276 |
F |
clathrin binding |
| GO:0031201 |
C |
SNARE complex |
| GO:0031340 |
P |
positive regulation of vesicle fusion |
| GO:0032024 |
P |
positive regulation of insulin secretion |
| GO:0045956 |
P |
positive regulation of calcium ion-dependent exocytosis |
| GO:0048791 |
P |
calcium ion-regulated exocytosis of neurotransmitter |
| GO:0098793 |
C |
presynapse |
|
Transcript Level | FPKM:0.00 TPM:0.00 |
| ORF Entry | |
Sequence (Nucleotide) | GTGACGCGAAAGTTCGGTGGGTCGTGTTTCGAAAAGAAATTCTTCATTCCAAACTGGATT
CAAATTGCGCCATTTGATTGAAGTTTTGTGTTTTTTATGATATGGGTCTGGATCAAGATT
ATGGAAAACCAAACGATTTCCTGGGGAGCCTTATATTGGGAGCGAGCAGTAAAGGCAGAA
GGCTAAAGCACTGGATGGATTGTATCAAATACCCCG
(216 bp) |