SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaASG_c12742_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		peroxidasin_[Bombyx_mori]
Ontology
GO:0000166 F nucleotide binding
GO:0001525 P angiogenesis
GO:0001541 P ovarian follicle development
GO:0001570 P vasculogenesis
GO:0001934 P positive regulation of protein phosphorylation
GO:0001936 P regulation of endothelial cell proliferation
GO:0001938 P positive regulation of endothelial cell proliferation
GO:0001945 P lymph vessel development
GO:0002042 P cell migration involved in sprouting angiogenesis
GO:0002053 P positive regulation of mesenchymal cell proliferation
GO:0003157 P endocardium development
GO:0003158 P endothelium development
GO:0004672 F protein kinase activity
GO:0004713 F protein tyrosine kinase activity
GO:0004714 F transmembrane receptor protein tyrosine kinase activity
GO:0005021 F vascular endothelial growth factor-activated receptor activity
GO:0005178 F integrin binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005576 C extracellular region
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005768 C endosome
GO:0005769 C early endosome
GO:0005783 C endoplasmic reticulum
GO:0005794 C Golgi apparatus
GO:0005886 C plasma membrane
GO:0005887 C integral component of plasma membrane
GO:0006468 P protein phosphorylation
GO:0007169 P transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007275 P multicellular organism development
GO:0008284 P positive regulation of cell population proliferation
GO:0008360 P regulation of cell shape
GO:0009897 C external side of plasma membrane
GO:0009986 C cell surface
GO:0010595 P positive regulation of endothelial cell migration
GO:0014068 P positive regulation of phosphatidylinositol 3-kinase signaling
GO:0016020 C membrane
GO:0016021 C integral component of membrane
GO:0016023 C cytoplasmic vesicle
GO:0016239 P positive regulation of macroautophagy
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016477 P cell migration
GO:0016740 F transferase activity
GO:0018108 P peptidyl-tyrosine phosphorylation
GO:0019838 F growth factor binding
GO:0030054 C cell junction
GO:0030097 P hemopoiesis
GO:0030154 P cell differentiation
GO:0030324 P lung development
GO:0030335 P positive regulation of cell migration
GO:0030513 P positive regulation of BMP signaling pathway
GO:0030949 P positive regulation of vascular endothelial growth factor receptor signaling pathway
GO:0031410 C cytoplasmic vesicle
GO:0035162 P embryonic hemopoiesis
GO:0035584 P calcium-mediated signaling using intracellular calcium source
GO:0035924 P cellular response to vascular endothelial growth factor stimulus
GO:0038033 P positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway
GO:0038083 P peptidyl-tyrosine autophosphorylation
GO:0038085 F vascular endothelial growth factor binding
GO:0043066 P negative regulation of apoptotic process
GO:0043129 P surfactant homeostasis
GO:0043410 P positive regulation of MAPK cascade
GO:0045121 C membrane raft
GO:0045165 P cell fate commitment
GO:0045446 P endothelial cell differentiation
GO:0045601 P regulation of endothelial cell differentiation
GO:0045766 P positive regulation of angiogenesis
GO:0046777 P protein autophosphorylation
GO:0048010 P vascular endothelial growth factor receptor signaling pathway
GO:0048286 P lung alveolus development
GO:0048469 P cell maturation
GO:0048597 P post-embryonic camera-type eye morphogenesis
GO:0048754 P branching morphogenesis of an epithelial tube
GO:0050679 P positive regulation of epithelial cell proliferation
GO:0050927 P positive regulation of positive chemotaxis
GO:0051770 P positive regulation of nitric-oxide synthase biosynthetic process
GO:0051894 P positive regulation of focal adhesion assembly
GO:0051901 P positive regulation of mitochondrial depolarization
GO:0055074 P calcium ion homeostasis
GO:0060837 P blood vessel endothelial cell differentiation
GO:0070374 P positive regulation of ERK1 and ERK2 cascade
GO:0071944 C cell periphery
GO:0090141 P positive regulation of mitochondrial fission
GO:0097443 C sorting endosome
GO:1901532 P regulation of hematopoietic progenitor cell differentiation
GO:1903010 P regulation of bone development
GO:2000352 P negative regulation of endothelial cell apoptotic process
GO:2001214 P positive regulation of vasculogenesis
Transcript
Level		FPKM:5.35 TPM:4.18
ORF Entry
Sequence
(Nucleotide)
GTTACTGCTCCGCCATCTTTTATAGTGGTTCCCACGAATCAGACAGCTATTATCGGAGAT
AACGTTTGGTTTACGTGTAAAGCGAAGGGAACTCCAAAACCTTCGATTAAATGGTATAGA
AATACGGTAATATTACCTATAACTGAAAATATTGTGCTGAGTGATGATAATCAAAATTTA
ACTTTATTGGAAGTGACTAGAGATGATGATGCTATATATCACTGCAGAGCAGAAAATGAT
GGGGG
(245 bp)

- SilkBase 1999-2023 -