SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaASG_c12736_g1_i1
Scaffold_id
NCBI non-redundant
(nr)		serine/threonine-protein_kinase_BRSK2_[Bombyx_mori]
Ontology
GO:0000086 P G2/M transition of mitotic cell cycle
GO:0000166 F nucleotide binding
GO:0000287 F magnesium ion binding
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005737 C cytoplasm
GO:0005783 C endoplasmic reticulum
GO:0005813 C centrosome
GO:0005815 C microtubule organizing center
GO:0005856 C cytoskeleton
GO:0006468 P protein phosphorylation
GO:0006887 P exocytosis
GO:0006915 P apoptotic process
GO:0007049 P cell cycle
GO:0007067 P mitotic cell cycle
GO:0007399 P nervous system development
GO:0007409 P axonogenesis
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0018105 P peptidyl-serine phosphorylation
GO:0019901 F protein kinase binding
GO:0030010 P establishment of cell polarity
GO:0030182 P neuron differentiation
GO:0031532 P actin cytoskeleton reorganization
GO:0035556 P intracellular signal transduction
GO:0036503 P ERAD pathway
GO:0046872 F metal ion binding
GO:0048471 C perinuclear region of cytoplasm
GO:0048812 P neuron projection morphogenesis
GO:0050321 F tau-protein kinase activity
GO:0051117 F ATPase binding
GO:0051301 P cell division
GO:0061178 P regulation of insulin secretion involved in cellular response to glucose stimulus
GO:0070059 P intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress
Transcript
Level		FPKM:8.11 TPM:6.35
ORF Entry
Sequence
(Nucleotide)
CCGACGGCGCAGGCCCCACCCTCACTCTTCCCCAACATAGGACAGATTGGAGGCGTCCCT
AACGCTGCGACAAGCGCATCGGCCCCATGGAGGGTGCGTTTGGCCACCATCAAGAACTCG
TTCCTGGGTTCGCCGAGATTTCATAGGCGGAAAATGCAGACATCATCGGAGGAAGTTCAT
CTAACGCCCGAATCATCACCGGAG
(204 bp)

- SilkBase 1999-2023 -