SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18

Bombyx mori Assembled RNA-Seq Entry

NameA_BomaASG_c10483_g1_i2
Scaffold_id
NCBI non-redundant
(nr)		probable_serine/threonine-protein_kinase_DDB_G0278901_isoform_X2_[Bombyx_mori]
Ontology
GO:0000082 P G1/S transition of mitotic cell cycle
GO:0000166 F nucleotide binding
GO:0000307 C cyclin-dependent protein kinase holoenzyme complex
GO:0000785 C chromatin
GO:0002088 P lens development in camera-type eye
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0004693 F cyclin-dependent protein serine/threonine kinase activity
GO:0005524 F ATP binding
GO:0005634 C nucleus
GO:0005667 C transcription regulator complex
GO:0005730 C nucleolus
GO:0005737 C cytoplasm
GO:0005829 C cytosol
GO:0005923 C bicellular tight junction
GO:0006468 P protein phosphorylation
GO:0007049 P cell cycle
GO:0007165 P signal transduction
GO:0007623 P circadian rhythm
GO:0008284 P positive regulation of cell population proliferation
GO:0009636 P response to toxic substance
GO:0010033 P response to organic substance
GO:0010288 P response to lead ion
GO:0010468 P regulation of gene expression
GO:0010971 P positive regulation of G2/M transition of mitotic cell cycle
GO:0016020 C membrane
GO:0016301 F kinase activity
GO:0016310 P phosphorylation
GO:0016740 F transferase activity
GO:0030332 F cyclin binding
GO:0031100 P animal organ regeneration
GO:0031965 C nuclear membrane
GO:0032403 F protein-containing complex binding
GO:0033574 P response to testosterone
GO:0042127 P regulation of cell population proliferation
GO:0042493 P response to xenobiotic stimulus
GO:0043065 P positive regulation of apoptotic process
GO:0045727 P positive regulation of translation
GO:0045793 P positive regulation of cell size
GO:0048146 P positive regulation of fibroblast proliferation
GO:0048471 C perinuclear region of cytoplasm
GO:0051301 P cell division
GO:0051726 P regulation of cell cycle
GO:0055093 P response to hyperoxia
GO:0071157 P regulation of cell cycle
Transcript
Level		FPKM:0.00 TPM:0.00
ORF Entry
Sequence
(Nucleotide)
TGTGCTCTTCCGATCTGCTTCAAGCTCAGACATTAAGCTGGTTGGAGTTCGCTACTCTGG
CTCACGGGATAGCCGCCGCACTGGCACACCTACATACACCAATCGGGAACAAACCTTGCG
TGGTCCATCGCGACGTGAACAGCAACAACGTGCTCATAGCGAGCAACGGCACCGCCAGAC
TCGCCGACCTGGGTCTGGCCCAAGTCTTGCAGCT
(214 bp)

- SilkBase 1999-2023 -