SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20083
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf66
2037340 bp
UniRef
UniRef50_P48735 (73%/84)
Cluster: Isocitrate dehydrogenase [NADP], mitochondrial precursor (EC 1.1.1.42) (Oxalosuccinate decarboxylase) (IDH) (NADP(+)-specific ICDH); n=493; cellular organisms|Rep: Isocitrate dehydrogenase [NADP], mitochondrial precursor (EC 1.1.1.42) (Oxalosuccinate decarboxylase) (IDH) (NADP(+)-specific ICDH) - Homo sapiens (Human)
Ontology
GO:0000287 F magnesium ion binding
GO:0004450 F isocitrate dehydrogenase (NADP+) activity
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
GO:0005975 P carbohydrate metabolic process
Orthologue
Sequence
(Nucleotide)
CGGCACGAGACCGTTCTCGGCGTGTAATTTAAGCGTATTGTTCACTAAAAAAATCATATT
ATTATTAGCTTTGCAAGCGCGAGAACTCGTCGTAGATCCACGTAATCACGAGCAGTGGTG
AATACACGAACAATATCGAAACATGGCTAATACTAGTACAACAAAAATTCTAAAGTGTGT
AAACCAGTTTGCATCACTGACTAGAAACTATGGAACTGCTAAGAGAGTTGTGGCTGCTAA
ACCAGTTGTCGAGAGGATGGTGATGAGATGACACGCATCATGTGGGCTAAGATCAAAGAG
AGACTGATATTTCCATATGTTAAGGTGGATTGTCTTTACTTTGACTTGGGCCTCCCGCAT
CGTGACGCCACTGATGATCAGGTCACCATCGACTCAGCGCATGCCATTCTAAAGCATAAT
GTGGGCATCAAATGCGCTACTATCACACCTGATGAACAAAGAGTAGAAGAGTTCAAGTTG
AAGAAAATGTGGCTAAGCCCGAACGGAAGATCCGTAACATTTTGGGCGGTACAGTATTCC
GCGAACCGATATTGTGTCAGAGTATCCCGAGGGTTGTGCCTGGTTGGACGAAACCTATTG
TGATAGGCCGTCATGCGCACGGCGACCAATACAAGGCGCAAGATTTTGTTGTACCGAAAC
CCGGAAAGGTTGAACT
(676 bp)

- SilkBase 1999-2022 -