SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20080
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf5
8683647 bp
UniRef
UniRef50_A4I4M3 (37%/48)
Cluster: Putative uncharacterized protein; n=3; Leishmania|Rep: Putative uncharacterized protein - Leishmania infantum
Ontology
GO:0016021 C integral component of membrane
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCCGATCGCAGAGTCACAGTCAAATGCGAATGGCATTTATTTAATACAATAG
TGAATGTATATATTTTAAGAAATATTCCAGGAATTGTCACACAAGACCTAAACAACACAA
CCGCTATATCTACTGTATTAAGTTGAACAAGAACATTTCCACAGACATGGGTAATGCGTG
TGCTGCTTGTCTTGTCAATGGGATAGCTAAAGTCGTTCTATGGACTGGAAAAGGTTTATG
GTTATTAACTCTACTGGATTCAAGACTGTTGGGGTGGCAGCAGGGAGTCTGGCTGCTGCA
GCTATGTCATTCACTGGGAATGTCTCAGCTGCCAGTACTATTGCACAAGCTACCTCAAGA
ATGATGAGGGCATGATACACTAAAGGAAGAATATGAAGGGTCTCATTACTAAAACCGTGA
CCATAAATTTATATTAAAAAAAAGTTTAGAACAGTATTTTTATTGTATCTTTTTATTTGT
ACTTTGGTGGAAAATTTGTTTATCCCGACCCCAGCATTAATGTAACATTATATTACCATT
AAATTTTCCTTATGAAATGTTTTACTAAATTCAAGAAATAATTCAGGACGATTAGGTTAT
TTGTCCAGCTATATATACTTAGTCTGGCCATAAATACCGTTGCACTTAAAAAAAAAATCT
ATTGCATTAATCATTTATTACTTTTAGTGTGTTAGTTTAATACATAAAT
(709 bp)

- SilkBase 1999-2022 -