SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20079
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
chromo24
Bm_scaf107
1152854 bp
UniRef
UniRef50_Q9VZS3 (90%/43)
Cluster: Protein translation factor SUI1 homolog; n=11; Bilateria|Rep: Protein translation factor SUI1 homolog - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003743 F translation initiation factor activity
GO:0005515 F protein binding
GO:0006412 P translation
GO:0006413 P translational initiation
GO:0006417 P regulation of translation
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTTTTGGAGTTAACATAAATTGGCTGTTTGTCAGCGAGCACATAACAGCGC
GTTATCAGTGACAGTTATATTGTTGAGTGCGTAGTATCGCAGCGTTTCGTTGAAACAAAG
AGACCCTACGTTCAATCGTATGTCCATCCAGAATCTCAACACATTCGACCCATTCGCCGA
TGCTATCAAAAGCTCGGAGGACGACGTTCAAGATGGTTTAGTCCACGTCCGTATCCAGCA
ACGAAACGGGCGTAGACGCTGACTACGGTGCAAGGCCTTTCCTCGGAATATGACCTGAAG
AAGATCGTGCGGGCATGCAAGAAGGAGTTCGCGTGCAAGGTACGGTCGTGGAGCACCCGG
AGTACGGCGAGGTGCTGCAGCTTCAGGGCGACCAGCGAGAGAATATTTGCCAGTGGCTCA
CCAAATCCGGCTTAGTGAAGCCTGAACAACTCAAGGTGCACGGTTTCTAAGCCGCCCTGC
TAAAACATAACATGTCCACACTCAACATGTATTATGAGAGATTGCGCGTTGTAATTATAA
ATCCTATTAAAAATATGTATTTAGAGAGCACCGACGTCTACAGAGAAAAGAGAACACGGT
TGTCGCGCCTGTGCTTGCGACTTCCTCTGTGTATAAAATATTTAATCTTTATATTATCGC
CGCCGTCTCGTCTCATAAGTTGCAAAATAATCAATCGA
(698 bp)

- SilkBase 1999-2022 -