SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20078
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf42
3822572 bp
UniRef
UniRef50_UPI0000DB70D1 (39%/117)
Cluster: PREDICTED: similar to Karyopherin 3 CG1059-PA; n=1; Apis mellifera|Rep: PREDICTED: similar to Karyopherin 3 CG1059-PA - Apis mellifera
Ontology
GO:0005488 F binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATTCAAAATGCAGACATTGCCGAAGATGTGCGTCAAACGGCGGCCGTGCTG
TTACGAAGATTATTTAGTGCAGAATTCTTTGAGTTCTTCCCGAAATTGCCATTTGAGCAG
CAGACAGTGCTCAGAGAACAATTGTTACTCACCCTTCAAATGGATCTTTCCCAGTACTTA
CGAAGAAAGGTTTGTGATGTAGTCTCTGAACTGGCTAGGAATCATATTGATGACGATGGC
AACAACCAGTGGCCGAGTTCCTACAGTTCATGTTTACCTGTGCCAGTGCGCAAGATCCAA
ACATCAAAGAAGCTGGTATTAGAATGTTTACGTCTGTACCAGGTGTATTTGGAAATCGTC
AGACTGAAAACTTGGATGTGATAAAAGGCATGTTAATATCTGCTTTGCAGCCAAATGAAT
CAATGGCTTTGCGAACTCAGGCAGTTAAAGCTGTAGGCGCCTTTATACTACTACACGATA
AGGAGCCCATCATACAAAAGCATTTCAGGATGTTCTTCTACCTTTGATGCAGGTAATAGT
TCTGTCTATTGAAGCAGCTGATGATGACTCTGCATTGAAAGTACTCATTGAGTTAGCAGA
TCAACACCTAAATTTCTCCGACCCCAGTTGGAG
(633 bp)

- SilkBase 1999-2022 -