SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20076
JBrowseBomo_Scaf131
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf318
39863 bp
UniRef
UniRef50_UPI0000D56AE2 (50%/85)
Cluster: PREDICTED: similar to CG7945-PA, isoform A; n=3; Endopterygota|Rep: PREDICTED: similar to CG7945-PA, isoform A - Tribolium castaneum
Ontology
GO:0005515 F protein binding
GO:0006915 P apoptotic process
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTTGAATATTGACGTCAAAGAAAATTGTAAAGACTTTGTTTTGAGCTTGTT
AACAGCGCTGATCGATTAGCTTATACCTTTCAAAGAAAAACTGACGGTTTAGTGAAAGTG
CATCTCAAACTATGGAGGTGGATCAATTTGCATTAGAGATTGCGTATCCAGAGGGTTCAC
GACTACCCCTCATCGACGAATCCTCGGTTCTAGGAACGCAGGCGCCGAAAGACAGACTGA
TAGCAGTACTAGATAAGTCGAGATGCGAGTGGAGAGGCTCCGAAAAGACACAGTCAGGAT
TGAAGAAGAAAAGGACTCCTTACTTTCAACTTTAGACAGCATCAAACATTCAGAACTGCT
ATTGGATATATCGGAGTGTGATAAGGACGATATCACACGATACGCGGACCGCATCCTGTC
CCGGGCTATGACCGTAGAGGTGACAGTGCGCACTGACCGAGACCATCAGCAGGAGGAAGC
TCTGTATCAGGTGAACATGTACATCGATAGCTGGTGATGTCCGTGCACAACGACGCAGTG
AGTGCGCATTCCCGTTGCCAGACCTATATGAACGCGTGCACGTCTCAGCCGGACCCCAAC
GCGGGCACGACAAGAACTTTGAGACGGCCATCCTGGGCTGCACCTCGACGATCAGAAGCG
(660 bp)

- SilkBase 1999-2022 -