SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20075
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_UPI0000D5762A (63%/79)
Cluster: PREDICTED: similar to CG6040-PA; n=1; Tribolium castaneum|Rep: PREDICTED: similar to CG6040-PA - Tribolium castaneum
Ontology
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATCAAAACGATTTGACTCCGAAGACCACAACTAACAAACTCAGAGTGCGGA
AAGGCAGGAGCGTGGTGCACAGAAACTTGGAGGACAATTACGGTGCAGTCGTTATTGCGA
ATCACGAAGCTCTGGCGCAGGTCTTAGAACAGGTTCAGCAGAGTGCGACAATGCAGCCCT
CGCTACGAGGTTTAAAAGCTTGCACAAATCTCCGTTGGAGTGATTTCACGGTGCAGCCGA
AGTCGTCCGTCAAGCCGGCAGGAGAATATTCTGTCCGGCCGTGTGGAACTCCAATAGTCC
GGTCAACGTGACCCTCATGCTGTACAAGGAGCAGATGGCCTCGCAGATCGTCTGCCAGCA
GTCCGTGCAGCCGCAGACGCTGAGTCTAAATGCCATTACCGAGTTCTGTGATTTGGTACC
CAGACAACAGTTTGGCGAAGACGGAGACGATTTAGTACAAGCAACCATCGTGGTTTTGGC
CCAAGCACAGGTGGACACCTTACAAAGCATGGCCAAAGTCTTCGCTCCGTCGAAGCTCTT
TCGACCAACTCCCAACTCGTGCCAACTGAACAGGTGCACGAAGCTATCTTCATGATGCTG
CAACTGATCAACGGCCTCAAGTGCCTTCAGGCGCGAGGGGTCGAGGAAATCTCGGAGACT
TTGTCCTCGTTCGTGGCGCTGAGGGAAGCCCAGGCTATACACGTTCCGGACGATA
(715 bp)

- SilkBase 1999-2022 -