SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20074
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_Q4U5R7 (35%/62)
Cluster: Protein 7; n=2; Cypovirus 14|Rep: Protein 7 - Heliothis armigera cypovirus 14
Ontology
GO:0000166 F nucleotide binding
GO:0004813 F alanine-tRNA ligase activity
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
GO:0006412 P translation
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTTCGTCAGGGACAATGTCGGCTTCTAATGGAAAAATAATTGTTCAAATCG
GTCCAGTAGTTTCGGAGCCTATTCGAAACAGACAAACAAACAAATCTTTCCTCTTTATAA
TATTAGTATAGATAAATTTTAAATTATAGATAAACAAATAATATATATTTTTAGGACGCT
TCTCGTTGCTAACGCTCGCGCTGGACTGTAGCTACGCGCATGCGCACGAGTGCCGCGCAT
TCCCTCTCGCTCTGCTCTTTCTATTCCCCCTCCACAGGAGCGTTAAACGTTTAACTCAAC
CTTGTTGGAAGTCGCATTAGAAGTTTCACTTCAAAAATGAGTGTGTTCAAAATTTTGTTA
AGTTCAATTATACATATACATGTTTGTCAGTTTATTATGTTTATCTTATGCGAGTGGACG
AGGACTTGTGCACAGTACTAAAGTCTTACAAAAATGTATGACAGTAGCGTCTATATTGAT
AGTAGACAAAACTGTCTGTGTTGATGTAACGTGTGGACAGTTCAACGTGCCCTGTCCGGT
CTGGTAGCGGCGGTTAGGTGAAAATGTTATTTTCACATTAAATATTCAAATATACGTATG
TTATTTACTTCACGTAATAGTC
(622 bp)

- SilkBase 1999-2022 -