SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20072
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_A0NFU9 (57%/59)
Cluster: ENSANGP00000030714; n=1; Anopheles gambiae str. PEST|Rep: ENSANGP00000030714 - Anopheles gambiae str. PEST
Ontology
GO:0004246 F obsolete peptidyl-dipeptidase A activity
GO:0006508 P proteolysis
GO:0016020 C membrane
GO:0004180 F carboxypeptidase activity
GO:0008233 F peptidase activity
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCACACGAATAGGCTGGCGTATATTTCTAATTACACCAGAACATCGCGAATT
CAAACCAACAAAAAAAAACATCAATGAAGTTTTCGTCCAACGCCTAATTAATACAAGTAA
GTTTTATCTACGATGCTGAAAGTNGGGGGCGGTGCGGTATTGATCGCGGCGATCGTTGCC
GTGTTCATCGTGGCCACGCAGGGACGAGACCCGGACCTCGAGGCGCGGGAGCACGAGGCG
CGGGAGTACATGCTCATCTGGACAAAGCGACCGGCCTGAGGAAGAACAGGGCCAGCTTAG
CCGAATGGGAGTACACCTCGAATATCACGAAGGAGAACGAAGAGAAATCGATACAAACTC
ACCTGGAGCTCTCCCGTCAAGAGAAAGCAGCCTGGGAGGAGACCAAGATGTACGGGTGGC
AGGACTTCCAGGATTTCACGTTGCGTAGAATGTTCAAGAAATACAGTCAGCTGGGCGTTG
CGGCTCTGCCTGACGACAAATTCCAAGCTTGATGAGAACTGTATCGGGAATGGAATCGAA
TTACGCCACCGCGAAGATCTGCTCGTACAAGAATGAGAGTAAATGCGATCTATCTTTGGA
GCCTGAGATAACTGAGATATTCTCCACGAGCCAAGACCCTGAGGAGTTGAAACATGCCTG
GGTGGAATGGCACAACGCGGCCGGTGCGACA
(691 bp)

- SilkBase 1999-2022 -